2025-04-04 14:11:37, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_031791521 2204 bp mRNA linear VRT 09-DEC-2019 DEFINITION PREDICTED: Oncorhynchus kisutch butyrophilin subfamily 3 member A2-like (LOC109886139), transcript variant X2, mRNA. ACCESSION XM_031791521 VERSION XM_031791521.1 DBLINK BioProject: PRJNA378663 KEYWORDS RefSeq. SOURCE Oncorhynchus kisutch (coho salmon) ORGANISM Oncorhynchus kisutch Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii; Salmoniformes; Salmonidae; Salmoninae; Oncorhynchus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_034189.2) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Oncorhynchus kisutch Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2204 /organism="Oncorhynchus kisutch" /mol_type="mRNA" /isolate="150728-3" /db_xref="taxon:8019" /sex="female" /tissue_type="muscle" /dev_stage="juvenile" /geo_loc_name="Canada: Vancouver" /linkage_group="LG16" /note="double haploid" gene 1..2204 /gene="LOC109886139" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 long SRA read, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:109886139" CDS 210..2069 /gene="LOC109886139" /codon_start=1 /product="protein CROWDED NUCLEI 3-like isoform X2" /protein_id="XP_031647381.1" /db_xref="GeneID:109886139" /translation="
MKTFPTSAVWCFGILFISASLITTGSSEVQVVGPADRVDALAGDDIILPCSLKPNISAKDMLVQWTGLYLKTRNVHLYRQGRDSNEDQFPSYRGRTSMFHEELKNGNVSLKLTRVTLSDAGSYRCFLPTLTSQVKETTVQLFVGAVSQPVISIVGTKDWGVVLKCESGGWFPEPEMEWLDSSGTILPADGPPERHRDSEDLYALRRHVTVDQTDTNRFTCRVHQTEINHLKETEIHVPDDVFPKSHVGLIIGLSILLAVVVLAASAGVYKWRKHTDKVTRERDGLKGELMELREENNKLKIETDNVKMEREELREENNKLKIETDNVKMEREKFRKDNDKLKIETVELREENNKLKIETDNVKMEREELREENNKLKIETDKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREKFRKDNDNVKMEREKFRKDNDKLKIETDNVKMEREELREENNKLKIETDNVKMEREELREENNKLKIETDNVKMEREELREENNKLKIETDNVKMEREELREENKKLKKDKGKLKRPSNPIQSPPLQEVNRKQTPSQKSEGIEGMKLESFPAPEMETLPEG"
misc_feature 297..638 /gene="LOC109886139" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 345..359 /gene="LOC109886139" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 393..413 /gene="LOC109886139" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 531..545 /gene="LOC109886139" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 573..590 /gene="LOC109886139" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 615..626 /gene="LOC109886139" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 672..917 /gene="LOC109886139" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 690..704 /gene="LOC109886139" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 732..743 /gene="LOC109886139" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 825..839 /gene="LOC109886139" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 858..875 /gene="LOC109886139" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature <1026..1739 /gene="LOC109886139" /note="helix-rich Mycoplasma protein; Region: Mplasa_alph_rch; TIGR04523" /db_xref="CDD:275316" ORIGIN
ctagaagtactgtaagtgaaagtgaaagtaaagtgtgaaactccaccacccttttcctccgttatttctggaacagacgtcgtgttacattctgtgcgttgccaaattagcctttcaactgttttggtttatgtttctaaactcctaataattttattcaccagttacaaacagctttaccttggagtcagacttgttttgttagtgaaatgaagacctttccgacctcggcggtctggtgttttgggattctgttcatcagtgcttcattgataacgacagggtcgtctgaggttcaggttgttggaccggctgaccgagttgatgccttagctggtgatgacatcattctaccatgttccctgaaacccaatattagtgctaaggacatgctagtgcagtggacaggattgtacctgaaaacaagaaacgtccatctttatcgtcaaggtcgagactccaatgaggatcagtttccatcctacaggggaaggacatcaatgtttcatgaagaactgaagaacggcaacgtctccttaaagctgaccagagttactctctctgatgctggaagctacaggtgcttccttccaacactgaccagccaggtgaaggaaaccactgttcaactctttgttggtgctgtatctcagccagtgatctctattgttggaactaaagactggggggtggtcctgaagtgtgagtctggaggctggtttcctgaacctgagatggagtggctggacagttctggaaccatcctccctgctgatggacctccagagagacacagggactcagaggacctctacgctctgagacgacatgtcactgtggaccagactgacaccaacaggttcacctgtagagttcaccagacggagatcaatcacctgaaggagacagagattcatgtcccagatgacgtgtttcctaaatcacacgtagggttgattattggtctgtcaatactattagctgttgtagttctcgcagcttcagctggtgtctacaagtggagaaaacatacagacaaggtcacaagagagagggatggactcaaaggagagctgatggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgtggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaagaagctgaaaaaagacaaaggaaagctgaagagaccatccaatccaatccaatctccacctctccaggaggtcaacaggaaacagactccttcccaaaagtctgaggggattgaagggatgaagctggagtcttttcctgctcctgagatggagactttacctgaaggatgatctggagaagttgtgggtggaagttgagtttctatagagctgagttactatagagagactataactatagagctgagttactatagagagactataactatagagagactataactatagagagactataactat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]