2024-04-26 15:04:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_031643684 3433 bp mRNA linear PLN 15-AUG-2022 DEFINITION PREDICTED: Nymphaea colorata protein argonaute 7 (LOC116263874), transcript variant X6, mRNA. ACCESSION XM_031643684 VERSION XM_031643684.2 DBLINK BioProject: PRJNA587754 KEYWORDS RefSeq. SOURCE Nymphaea colorata (pocket water lily) ORGANISM Nymphaea colorata Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Nymphaeales; Nymphaeaceae; Nymphaea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045148.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Aug 15, 2022 this sequence version replaced XM_031643684.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Nymphaea colorata Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3433 /organism="Nymphaea colorata" /mol_type="mRNA" /isolate="Beijing-Zhang1983" /db_xref="taxon:210225" /chromosome="11" /tissue_type="young leaf" /country="China: Beijing" gene 1..3433 /gene="LOC116263874" /note="protein argonaute 7; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 15 Proteins" /db_xref="GeneID:116263874" CDS 278..2941 /gene="LOC116263874" /codon_start=1 /product="protein argonaute 7" /protein_id="XP_031499544.1" /db_xref="GeneID:116263874" /translation="
MHQVNTIQEVDAVSYGKQQLDTHFQLLVAMKRPDSGGKQGIPVRLVANHFLVEFDSSLPVFHYDIKISPAPSKEISRLIKQNFVEENSLFSGSFPVFDGRRNLYSPIRFQSDRLDFLVNLPLPASSSTGCSNMTQRHKLFKVSIKLVSRLDGTDLIRCLASDEEHHVPLPQEYLHALDVVLREYPTENCIPINRSFYSRSMGEERSIGGGAVGLGGFFQSLRPTQQGLALNVNFSVAAFHESISIIQYLQKRFNSLRDLSQRKTRTLMGEERNEVEKALRNIRIFVCHRDTDQRFRVFSLTSETTENLRFESKDGELLRVVDYFKQHYNHDIQFRNLPCLQISRTKPCYIPMELCIVCEGQKYISKLSDEQTRKILQLGCQKPRERMGIINGLMHGDVGPTSLKYAKGFRLHVSQEMTKLNGRLLSPPRLRLGNNGRVRDIIPSNQDRQWNMIDSHVLEAVRINRWALVSFGGTPQQHSCIPRFIFQLAQRCEKLGITLNRMTIRRPQFEQIQALNNASRLETILRDVQEAASGNLQLVICVMEKKHKGYADLKRIAETKIGVISQCCLYPNLSRLSPQFLTNLALKINAKAGGSTVALFNPLPWQNPRLFADDEPAMFMGADVTHPHPLDDYSPSIAAVVGSMNWPFANKYISRMRSQRHRQEIILDLQEMVEELLDDFCHGIGQHPKRIIFFRDGVSETQFYKVLQEELKAIKSACQRVPDYNPSITFVVVQKRHHTRLFLDELNSKIANSHGNIPPGTVVDTVITHPREFDFFLCSHSGVRGTSRPTHYHVLWDESHFSSDELQQLIHNLCYTFVRCTKPVSLVPPAYYAHLAAYRGRMYLERAVSAAMSSSPSRFALSRPAPPLVTIPLPKPDDKVKKLMFYC"
misc_feature 557..820 /gene="LOC116263874" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 848..1000 /gene="LOC116263874" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 1073..1402 /gene="LOC116263874" /note="PAZ domain; Region: PAZ; pfam02170" /db_xref="CDD:426635" misc_feature order(1160..1162,1205..1207,1235..1237,1247..1249, 1301..1303,1319..1321,1325..1327) /gene="LOC116263874" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1487..2809 /gene="LOC116263874" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1925..1927,1937..1939,1973..1984,1991..1993, 2015..2017,2024..2026,2036..2038,2048..2050) /gene="LOC116263874" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2144..2146,2150..2152,2363..2365,2777..2779) /gene="LOC116263874" /note="active site" /db_xref="CDD:240015" ORIGIN
cgagcatgcaagtgccaagagcagtcctccgcgtttatcccaaggcccaaccaacgggaaagccggtggcccgacttcttcgcagcgcagcgtcagccacctttgtttggaggctctggcgtgcctgtaaatcgtctgcactgtcgcggcaaaagagacgccatgtttttaaaaactttctttcctttttgccttttttttgtcgttgacgtaacaagactggctgactgaggggttcgactttcgagctccaactctttcctctgttgatgagataatgcatcaagttaacacaattcaagaagttgatgctgtttcttatgggaaacaacagctggacacacattttcagctgttggtggcaatgaagagacctgattctggtggaaagcaaggaattccagttcgtcttgttgcaaaccatttcctggttgaatttgattcttccctgccagtgttccactatgacatcaaaatatctccggcaccatcaaaagagatctcaaggctcatcaaacaaaattttgtcgaggagaactcacttttttctggcagcttcccagtctttgatggtagaagaaacctctatagccccatcaggtttcagagcgacaggctggatttccttgtcaatctgcccttacctgcctcctcatccactggatgttccaatatgacacagaggcataaacttttcaaggtaagcatcaagctggtatcaagactcgatgggacagacttgattcgctgcttggcaagtgatgaagagcatcatgtccctcttcctcaagaataccttcatgccttagatgttgttctcagggagtatccaaccgagaactgcataccaataaacaggtctttctattcaaggtcaatgggggaggagaggagcattggtggaggagctgttggattgggaggattctttcaaagccttcgaccaacacaacaaggtcttgccctcaatgttaatttctcggtggcagctttccatgagagcattagcattattcagtatcttcaaaagcgttttaactctctgagggatttgtcccagaggaagacaagaactctgatgggtgaagagaggaatgaggttgagaaggccctaaggaacatccggatctttgtgtgccacagggatactgatcaaaggtttagagtttttagcttaaccagtgaaacgacagagaatttaagattcgagagtaaggatggggagttgctaagggtggtggattacttcaaacagcactacaaccatgacatccagttccggaatttgccatgcttgcagatcagcagaaccaaaccatgttatattccaatggagctctgcattgtctgtgagggccagaaatacattagcaagctctctgatgaacagaccaggaagatccttcagttgggctgccagaaaccgagggaaagaatggggattatcaatggtctcatgcatggagatgttggaccaacaagtcttaaatatgcaaaagggtttaggctgcatgtttctcaagaaatgaccaagttaaacggaagattacttagtcctccccggttgaggcttggcaacaatggtcgcgttagggacataatcccatctaaccaggatcgtcaatggaatatgattgacagccacgtcctggaggccgtgaggatcaacagatgggcgctcgtaagttttgggggcacccctcaacagcattcgtgtattcccagatttattttccagcttgctcagagatgtgagaaattaggtattactctaaaccgaatgaccataaggcggccacagtttgagcagattcaagcactgaacaatgcctccaggcttgaaaccatactgagagatgtccaagaagctgcatctggtaatctgcagctggtcatctgcgtcatggagaaaaagcacaaaggttatgctgatttgaaacgtattgcagaaacaaaaataggtgttataagtcagtgctgtctataccccaacctgagcaggttgagtccccagttcctgaccaatttagccttgaaaataaatgccaaggctggtggaagcacagtggcattgttcaatcccctgccttggcaaaacccccgtttgtttgctgatgatgagcctgcaatgtttatgggtgccgatgtgactcatccccatccacttgatgactacagtccgtccattgcagctgtggttggtagcatgaactggccatttgcaaataaatacatatcgaggatgagatctcaaaggcatagacaggaaatcattctagatctacaggaaatggtggaagaattgctggatgatttctgccacgggatcggccaacatcccaaaagaataattttcttccgagatggagtcagcgagacccagttctacaaagtgttgcaggaggagctgaaggctatcaaatcagcttgtcagagggttcctgactacaacccgtccataacttttgtggttgtccaaaaaaggcatcacaccagactgtttcttgatgagctgaacagcaaaattgctaacagtcatggaaacattccacctggaacagtcgtggatacagtgatcacacatccaagggagtttgatttttttctctgtagtcactctggggtgagaggtaccagccgaccaactcactaccatgttctttgggacgagagtcatttcagttctgatgaactacagcaactgatacacaacttgtgctacacttttgttagatgcacaaagcctgtctcattggtaccaccagcttactacgctcatcttgctgcatatcgtggtagaatgtatcttgaaagagctgtgtctgcggcaatgagctcaagtccctccagattcgctctctcaaggcctgcacctccattggtgactattccattgcccaaaccagatgacaaagtgaagaagctgatgttctactgctgacaccatcggattcttgtatatagctggtgttgtgccctttgtgaacttgtgacatgccgaaagttagtcaagtttaccagtcagcaataaggatatcaagtttcacctaggcgtcttaaacgggtaaaagttggaattcctttctgtaagattcttcaagcgcttatttaacttttaaggcttcataacgttcattgatttgcctaaattgctagtaaaaggtgcaggatacttgtgtacaagggcccaaatgtttggtctttcaaaaagaaaagaaaaaacacgaagttgcaacttgtggatgcaaataaattgtagccttgaaggtagtatgaattactgaatggataaaaatcttatgttaaatgcgtagcaaaacaccaggtagcagagatttcattgatgtttcttgaagcttcatttctttacctttcatcaagcagcaaatttctcaacctggtgatccattagtaaatctgaccacttaattga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]