GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 15:04:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_031643684            3433 bp    mRNA    linear   PLN 15-AUG-2022
DEFINITION  PREDICTED: Nymphaea colorata protein argonaute 7 (LOC116263874),
            transcript variant X6, mRNA.
ACCESSION   XM_031643684
VERSION     XM_031643684.2
DBLINK      BioProject: PRJNA587754
KEYWORDS    RefSeq.
SOURCE      Nymphaea colorata (pocket water lily)
  ORGANISM  Nymphaea colorata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Nymphaeales; Nymphaeaceae; Nymphaea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045148.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 15, 2022 this sequence version replaced XM_031643684.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Nymphaea colorata Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3433
                     /organism="Nymphaea colorata"
                     /mol_type="mRNA"
                     /isolate="Beijing-Zhang1983"
                     /db_xref="taxon:210225"
                     /chromosome="11"
                     /tissue_type="young leaf"
                     /country="China: Beijing"
     gene            1..3433
                     /gene="LOC116263874"
                     /note="protein argonaute 7; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 15
                     Proteins"
                     /db_xref="GeneID:116263874"
     CDS             278..2941
                     /gene="LOC116263874"
                     /codon_start=1
                     /product="protein argonaute 7"
                     /protein_id="XP_031499544.1"
                     /db_xref="GeneID:116263874"
                     /translation="
MHQVNTIQEVDAVSYGKQQLDTHFQLLVAMKRPDSGGKQGIPVRLVANHFLVEFDSSLPVFHYDIKISPAPSKEISRLIKQNFVEENSLFSGSFPVFDGRRNLYSPIRFQSDRLDFLVNLPLPASSSTGCSNMTQRHKLFKVSIKLVSRLDGTDLIRCLASDEEHHVPLPQEYLHALDVVLREYPTENCIPINRSFYSRSMGEERSIGGGAVGLGGFFQSLRPTQQGLALNVNFSVAAFHESISIIQYLQKRFNSLRDLSQRKTRTLMGEERNEVEKALRNIRIFVCHRDTDQRFRVFSLTSETTENLRFESKDGELLRVVDYFKQHYNHDIQFRNLPCLQISRTKPCYIPMELCIVCEGQKYISKLSDEQTRKILQLGCQKPRERMGIINGLMHGDVGPTSLKYAKGFRLHVSQEMTKLNGRLLSPPRLRLGNNGRVRDIIPSNQDRQWNMIDSHVLEAVRINRWALVSFGGTPQQHSCIPRFIFQLAQRCEKLGITLNRMTIRRPQFEQIQALNNASRLETILRDVQEAASGNLQLVICVMEKKHKGYADLKRIAETKIGVISQCCLYPNLSRLSPQFLTNLALKINAKAGGSTVALFNPLPWQNPRLFADDEPAMFMGADVTHPHPLDDYSPSIAAVVGSMNWPFANKYISRMRSQRHRQEIILDLQEMVEELLDDFCHGIGQHPKRIIFFRDGVSETQFYKVLQEELKAIKSACQRVPDYNPSITFVVVQKRHHTRLFLDELNSKIANSHGNIPPGTVVDTVITHPREFDFFLCSHSGVRGTSRPTHYHVLWDESHFSSDELQQLIHNLCYTFVRCTKPVSLVPPAYYAHLAAYRGRMYLERAVSAAMSSSPSRFALSRPAPPLVTIPLPKPDDKVKKLMFYC"
     misc_feature    557..820
                     /gene="LOC116263874"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    848..1000
                     /gene="LOC116263874"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    1073..1402
                     /gene="LOC116263874"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:426635"
     misc_feature    order(1160..1162,1205..1207,1235..1237,1247..1249,
                     1301..1303,1319..1321,1325..1327)
                     /gene="LOC116263874"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1487..2809
                     /gene="LOC116263874"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1925..1927,1937..1939,1973..1984,1991..1993,
                     2015..2017,2024..2026,2036..2038,2048..2050)
                     /gene="LOC116263874"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2144..2146,2150..2152,2363..2365,2777..2779)
                     /gene="LOC116263874"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
cgagcatgcaagtgccaagagcagtcctccgcgtttatcccaaggcccaaccaacgggaaagccggtggcccgacttcttcgcagcgcagcgtcagccacctttgtttggaggctctggcgtgcctgtaaatcgtctgcactgtcgcggcaaaagagacgccatgtttttaaaaactttctttcctttttgccttttttttgtcgttgacgtaacaagactggctgactgaggggttcgactttcgagctccaactctttcctctgttgatgagataatgcatcaagttaacacaattcaagaagttgatgctgtttcttatgggaaacaacagctggacacacattttcagctgttggtggcaatgaagagacctgattctggtggaaagcaaggaattccagttcgtcttgttgcaaaccatttcctggttgaatttgattcttccctgccagtgttccactatgacatcaaaatatctccggcaccatcaaaagagatctcaaggctcatcaaacaaaattttgtcgaggagaactcacttttttctggcagcttcccagtctttgatggtagaagaaacctctatagccccatcaggtttcagagcgacaggctggatttccttgtcaatctgcccttacctgcctcctcatccactggatgttccaatatgacacagaggcataaacttttcaaggtaagcatcaagctggtatcaagactcgatgggacagacttgattcgctgcttggcaagtgatgaagagcatcatgtccctcttcctcaagaataccttcatgccttagatgttgttctcagggagtatccaaccgagaactgcataccaataaacaggtctttctattcaaggtcaatgggggaggagaggagcattggtggaggagctgttggattgggaggattctttcaaagccttcgaccaacacaacaaggtcttgccctcaatgttaatttctcggtggcagctttccatgagagcattagcattattcagtatcttcaaaagcgttttaactctctgagggatttgtcccagaggaagacaagaactctgatgggtgaagagaggaatgaggttgagaaggccctaaggaacatccggatctttgtgtgccacagggatactgatcaaaggtttagagtttttagcttaaccagtgaaacgacagagaatttaagattcgagagtaaggatggggagttgctaagggtggtggattacttcaaacagcactacaaccatgacatccagttccggaatttgccatgcttgcagatcagcagaaccaaaccatgttatattccaatggagctctgcattgtctgtgagggccagaaatacattagcaagctctctgatgaacagaccaggaagatccttcagttgggctgccagaaaccgagggaaagaatggggattatcaatggtctcatgcatggagatgttggaccaacaagtcttaaatatgcaaaagggtttaggctgcatgtttctcaagaaatgaccaagttaaacggaagattacttagtcctccccggttgaggcttggcaacaatggtcgcgttagggacataatcccatctaaccaggatcgtcaatggaatatgattgacagccacgtcctggaggccgtgaggatcaacagatgggcgctcgtaagttttgggggcacccctcaacagcattcgtgtattcccagatttattttccagcttgctcagagatgtgagaaattaggtattactctaaaccgaatgaccataaggcggccacagtttgagcagattcaagcactgaacaatgcctccaggcttgaaaccatactgagagatgtccaagaagctgcatctggtaatctgcagctggtcatctgcgtcatggagaaaaagcacaaaggttatgctgatttgaaacgtattgcagaaacaaaaataggtgttataagtcagtgctgtctataccccaacctgagcaggttgagtccccagttcctgaccaatttagccttgaaaataaatgccaaggctggtggaagcacagtggcattgttcaatcccctgccttggcaaaacccccgtttgtttgctgatgatgagcctgcaatgtttatgggtgccgatgtgactcatccccatccacttgatgactacagtccgtccattgcagctgtggttggtagcatgaactggccatttgcaaataaatacatatcgaggatgagatctcaaaggcatagacaggaaatcattctagatctacaggaaatggtggaagaattgctggatgatttctgccacgggatcggccaacatcccaaaagaataattttcttccgagatggagtcagcgagacccagttctacaaagtgttgcaggaggagctgaaggctatcaaatcagcttgtcagagggttcctgactacaacccgtccataacttttgtggttgtccaaaaaaggcatcacaccagactgtttcttgatgagctgaacagcaaaattgctaacagtcatggaaacattccacctggaacagtcgtggatacagtgatcacacatccaagggagtttgatttttttctctgtagtcactctggggtgagaggtaccagccgaccaactcactaccatgttctttgggacgagagtcatttcagttctgatgaactacagcaactgatacacaacttgtgctacacttttgttagatgcacaaagcctgtctcattggtaccaccagcttactacgctcatcttgctgcatatcgtggtagaatgtatcttgaaagagctgtgtctgcggcaatgagctcaagtccctccagattcgctctctcaaggcctgcacctccattggtgactattccattgcccaaaccagatgacaaagtgaagaagctgatgttctactgctgacaccatcggattcttgtatatagctggtgttgtgccctttgtgaacttgtgacatgccgaaagttagtcaagtttaccagtcagcaataaggatatcaagtttcacctaggcgtcttaaacgggtaaaagttggaattcctttctgtaagattcttcaagcgcttatttaacttttaaggcttcataacgttcattgatttgcctaaattgctagtaaaaggtgcaggatacttgtgtacaagggcccaaatgtttggtctttcaaaaagaaaagaaaaaacacgaagttgcaacttgtggatgcaaataaattgtagccttgaaggtagtatgaattactgaatggataaaaatcttatgttaaatgcgtagcaaaacaccaggtagcagagatttcattgatgtttcttgaagcttcatttctttacctttcatcaagcagcaaatttctcaacctggtgatccattagtaaatctgaccacttaattga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]