2025-04-05 06:54:17, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_030914953 3499 bp mRNA linear PRI 25-SEP-2019 DEFINITION PREDICTED: Rhinopithecus roxellana nuclear factor kappa B subunit 1 (NFKB1), transcript variant X6, mRNA. ACCESSION XM_030914953 VERSION XM_030914953.1 DBLINK BioProject: PRJNA565017 KEYWORDS RefSeq. SOURCE Rhinopithecus roxellana (golden snub-nosed monkey) ORGANISM Rhinopithecus roxellana Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Colobinae; Rhinopithecus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044550.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Rhinopithecus roxellana Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3499 /organism="Rhinopithecus roxellana" /mol_type="mRNA" /isolate="Shanxi Qingling" /db_xref="taxon:61622" /chromosome="2" /sex="male" /tissue_type="heart" /dev_stage="adult" gene 1..3499 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 276 ESTs, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 12 samples with support for all annotated introns" /db_xref="GeneID:104662315" CDS 117..2984 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X4" /protein_id="XP_030770813.1" /db_xref="GeneID:104662315" /translation="
MFHLDPSLTHTIFNPEVFQPQMALPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDTESKKDSEGCDRSDDRNTVNLFGKVVETTEHNQEPSEATDGNGEVTLTYATRAKEESARVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMAASWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLLPASTRQQIDELRDSDSVCDSGVETSFRKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 201..806 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(243..245,249..254,258..263,270..281,504..506, 510..515,804..806) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 825..1130 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(828..830,834..842,846..854,972..980,1017..1019, 1053..1055,1110..1112,1119..1121,1125..1127) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(834..839,843..845,882..884,888..890,894..896, 993..998,1005..1007,1011..1013) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(897..899,903..905,996..1001) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1569..2351 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature order(1701..1703,1707..1709,1719..1724,1731..1739, 1743..1748,1758..1760,1767..1769,1812..1814,1818..1820, 1824..1826,1836..1841,1848..1856,1860..1865,1875..1877, 1884..1886,1911..1913,1917..1919,1923..1925,1935..1940, 1947..1955,1959..1964,1974..1976,1983..1985) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1701..1814 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1818..1913 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2025..2117 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2127..2225 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2520..2747 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
atatttgggaaggcctgaacaagcgtactaagatcttcggtactgcagaacttccaattatttactactaaggacaggagacaagctgtaatactggctactaaaagaaacgaaaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagatggcccatatcttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtttgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggcttcgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcgtgtataaggggctataatcctggactcttggtgcaccctgaccttgcctatttgcaagcagaaggtggaggggaccggcagttgggagatcgggaaaaagagctaatccgccaagcagctctgcagcaaaccaaggagatggacctcagcgtggtacggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagatgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggggaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggcggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatgttaatattacgaaaccagcctctgtgttcgtacagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctctactatcctgaaatcaaagataaagaagaagtacagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggtgggagtggcgctggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacagggccagggtatagcttcccgcactatggatttcctacttacggtgggattaccttccatcctggaactactaaatctaatgctgggatgaagcatggaaccatggacactgaatctaaaaaggactctgaaggttgtgacagaagtgatgacagaaacactgtaaacctctttgggaaagtcgttgaaaccacagagcacaatcaggagcccagcgaggccactgatgggaatggtgaggtcactctaacgtatgcaacaagagcaaaagaagagagtgctagggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactacgcagtgacaggagacgtgaagatgctgctggccgtccagcgccatctcactgccgtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggctggggccgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaatggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtttgctgctgctggtggccgctggggccgacgtcaatgctcaggagcaaaagtccgggcgcacagcactgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgacgcccatgtggacagtactacctacgatggaaccacacccctgcatatagcagctgggagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtgcctggaaccacgcctctagatatggccgccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactctggcacagaaattaggcctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggagggacagtcagagagctggtggaggctctgagacaaatgggctacactgaagcgattgaagtgatccaggcagcctccagcccagtgaagaccacctctcaggcccactcgctgcctctcttgcctgcctccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagtggcgtggagacgtccttccgcaaactcagctttactgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccgtataaaccaaagccctaaaattctactgcattgtccacaaaacagaagctgaagcgcatccagaggtgctcagagagccagcctgcctgaatcattctcgatataactcgagaccttttcaacttggcttcctttcttggttcataaacgaattttagtttggttcacttacagatagtatctagcaatcacagcactggctgagtggatgcatctggggatgaggttgcttactaagctttgccggctgctgccggatcacagctgctttctgttgtcattgcttttgtccctctgctacgttcctattgtcattaaaggtatcactgtctccacctggcattccttctgaccatccacaacatcgttttgcattcaaattaagggttaagaaaagggatattttaaaatgagagtcacttgacgtgccattttaaaaaaaagcatattgctttttctaatgtggttatttctctgatttgaaaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]