LOCUS       XM_026782069            2504 bp    mRNA    linear   ROD 15-OCT-2018
DEFINITION  PREDICTED: Microtus ochrogaster argonaute 4, RISC catalytic
            component (Ago4), transcript variant X2, mRNA.
ACCESSION   XM_026782069
VERSION     XM_026782069.1
DBLINK      BioProject: PRJNA210839
KEYWORDS    RefSeq.
SOURCE      Microtus ochrogaster (prairie vole)
  ORGANISM  Microtus ochrogaster
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Cricetidae; Arvicolinae; Microtus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_022016.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Microtus ochrogaster Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2504
                     /organism="Microtus ochrogaster"
                     /mol_type="mRNA"
                     /isolate="Prairie Vole_2"
                     /db_xref="taxon:79684"
                     /chromosome="10"
                     /sex="female"
     gene            1..2504
                     /gene="Ago4"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:101993046"
     CDS             38..2227
                     /gene="Ago4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X2"
                     /protein_id="XP_026637870.1"
                     /db_xref="GeneID:101993046"
                     /translation="

MEALGPGPPASLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDVDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQLLLEALAGHLNEVPDDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQEIAQELLYSQEVVQDLTSMARELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERAHIC"

     misc_feature    80..2191
                     /gene="Ago4"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    1187..>2212
                     /gene="Ago4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1598..1600,1610..1612,1646..1657,1664..1666,
                     1688..1690,1697..1699,1709..1711,1721..1723)
                     /gene="Ago4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
ORIGIN      

cgccggggaccggagcgaggcggcccccgtcgccgccatggaggcgctgggacccggacctccagccagccttttccagccacctcggcgtcctggccttggaactgttgggaagccaattcgactgttagccaatcattttcaggttcagatccctaaaatagatgtgtatcactatgatgtggatattaaaccagaaaaacggcctcgtagagtcaacagggaggtggtagacactatggtacgacacttcaagatgcagatatttggggatcggcagcctggttatgatggcaaaagaaacatgtacacagcacatccactgccaattggacgtgatagggttgacatggaggttaccctcccaggtgagggtaaagaccaaactttcaaagtgtctgtgcaatgggtgtcagttgtgagccttcagttgctcttagaagctttagctgggcacctaaatgaagtcccggatgattcagtacaagcacttgatgttattacaaggcatcttccctctatgaggtacactccggtgggccgttcttttttctcaccccctgaaggttattaccaccctctgggaggtggcagagaggtctggttcggctttcaccagtctgtgagacctgccatgtggaatatgatgctcaacattgatgtatctgcaactgctttttaccgggctcagcctatcattgagttcatgtgtgaggttttagacattcagaacatcaatgaacagacaaaacctctaacagactctcagcgtgtcaagtttaccaaagaaattagaggtctcaaagttgaggtgactcactgtggacagatgaaacgaaaataccgagtttgcaatgtgacaagacggccagccagtcatcaaacctttcctttgcagctagaaaatggtcaagctatggaatgtacagtagctcagtattttaagcagaagtatagtctgcaactgaaatacccccatcttccatgccttcaagtgggacaagagcaaaagcatacatacttgccacttgaggtctgtaatatagtggcaggacagagatgtataaagaagctcacagacaatcagacatccacaatgatcaaagccacagcgagatctgctcctgacagacaggaagaaatcagtagactggtgaagagcaatagcatggtgggtggacctgacccatacctgaaggaatttgggattgttgtccacaatgagatgacggagctcacaggcagggtgcttccagctccaatgctgcagtacggaggccggaataaaacagtagccacacccaaccagggtgtctgggacatgcgaggaaagcagttttatgctggcattgaaattaaagtttgggcagtggcttgttttgcgcctcagaaacaatgtagggaagatttactaaagagtttcaccgaccagcttcgtaaaatctccaaggatgcagggatgcccatccagggtcagccatgtttctgcaagtatgcacaaggtgcagacagtgtggagcccatgtttaaacacctgaaaatgacatatgtgggcctgcagctaatagtggttatcttgcctggaaagacaccagtatatgcggaggtgaaacgagttggagatacccttttaggtatggccacacaatgtgtccaggtcaaaaatgttgtcaagacctcaccccaaaccctttccaacctttgcctgaagataaatgcaaagcttggaggaattaacaatgtacttgtacctcatcaaaggccttcagtgttccagcagcctgtcatcttcctgggagcagatgtcactcatccacctgctggggatgggaagaagccttctattgcagccgtggtgggcagcatggacggccaccctagccgatactgtgccacagtgcgggtgcagacgtctcggcaggagattgcccaggagctgctctacagtcaggaggttgtgcaggacctgacgagcatggctcgggagctgctgattcaattctacaagtccacacgtttcaagcccactcgcatcatctactaccgcggaggggtgtcggagggacagatgaaacaggtagcttggccggagctaatagcaattcgaaaggcatgtataagcttggaggaagactatcgaccaggaataacctacattgtggtgcaaaagagacatcacacacgcctcttctgtgcagataaaacagaaagggcacacatttgctagacaccgaaggaggcagaaatgcctctgatgtgttccatgtgtgtgggaggcggatagacggcatggcagcagctgttactatgctcacatcctttcgagcactgctctagagccttccttgtggatccttttcatccgcacagcaacccgacgatggaagcacgggatcaccacatgctgcacaagagaaaaccgaggtacagagacgtgagatggtttgtccagtgttacagagctagtgaatggcagggcaaggattgaaacccagacagctcta

//