2024-03-29 10:21:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_025428639 1321 bp mRNA linear MAM 15-JUL-2022 DEFINITION PREDICTED: Canis lupus dingo claudin 7 (CLDN7), mRNA. ACCESSION XM_025428639 VERSION XM_025428639.2 DBLINK BioProject: PRJNA477859 KEYWORDS RefSeq. SOURCE Canis lupus dingo (dingo) ORGANISM Canis lupus dingo Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_064247) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jul 15, 2022 this sequence version replaced XM_025428639.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Canis lupus dingo Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1321 /organism="Canis lupus dingo" /mol_type="mRNA" /isolate="Sandy" /sub_species="dingo" /db_xref="taxon:286419" /chromosome="5" /sex="female" /tissue_type="muscle" gene 1..1321 /gene="CLDN7" /note="claudin 7; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 14 Proteins" /db_xref="GeneID:112647497" CDS 461..1096 /gene="CLDN7" /codon_start=1 /product="claudin-7" /protein_id="XP_025284424.1" /db_xref="GeneID:112647497" /translation="
MANSGLQLLGFALALVGWAGLVASTAIPQWQMSSYAGDNIITAQAMYKGLWMECVTQSTGMMSCKMYDSVLALSAALQATRALMVVSLVLGFLAMFVATMGMKCTNCGGDDKVKKARIAMTGGIIFIVGGLAALVACSWYGHQIVTDFYNPLVPMNIKYEFGPAIFIGWAGSALVILGGALLSCSCPGSESKAGYRAPRSYPKPNSAKEYV"
misc_feature 470..1006 /gene="CLDN7" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; pfam00822" /db_xref="CDD:395662" polyA_site 1321 /gene="CLDN7" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
tgacgccctacatatactcaggtgcgccgcacctgtccgcccgcacctggctgctcgcggctgagcagcctcgccctctccctgcagccccaggtctcccgcccagggcactttggggacctccagcctccaggacggcgcggacactgcccgactgccttttgtgtgagtagggtcgcccagagcgccggaggggaccgcccggccttcgcggatcgctctttggaccgccggtcctcgagcggagcctcttcctccagctgagaccctcgccccgccggaaggatcgatttattttctccgggtgacaaaaagatttgggaccaccgacccaaaccttctctttgggtgacttaagactccgccgcaagttgtctttccgtggggccgccccccaaatttgctttgtttcaccgcagggtcgcccacccggcgtccccaacctcatccgagggcgaacatggccaactcgggcctgcagctgctgggcttcgccctggccctggtgggctgggcgggcctggtggcgagcaccgccatcccgcagtggcagatgagctcgtacgcgggcgacaacatcatcacggcccaggccatgtacaaggggctgtggatggagtgcgtgacgcagagcaccggcatgatgagctgcaaaatgtacgactcggtgctggccctgtcggcggccttgcaggccacccgtgccctgatggtggtgtccctggtgctgggattcctggccatgtttgtggccacgatgggcatgaagtgtaccaactgtgggggagacgacaaagtgaagaaggcccgaatagctatgaccggaggcatcattttcattgtgggaggtcttgctgccttggtagcctgctcctggtacggccaccagattgtcacggacttctacaaccccctggtccccatgaatattaagtacgagtttggtcctgccatcttcattggctgggcagggtctgctctggtcattctgggaggtgccctgctctcttgctcctgtcctgggagcgagagcaaagctgggtaccgtgcaccccgctcctaccctaagcccaactctgccaaggagtacgtgtgagctgggacccccccccagccccagcctggcagcctctggtgtgcccaggtgctgaaatgacctggggggcagagctcagcccatgggtggggtgtggaactggagcctcgcctcatcaccccgcacaccatgtacagttcccagggtgggggtggggtggggtgggggagacaaaaagggaggatgtgctttttgtacagtaataaaaaaagtatgttttggaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]