2024-04-25 01:28:40, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_025425566 885 bp mRNA linear MAM 15-JUL-2022 DEFINITION PREDICTED: Canis lupus dingo claudin 11 (CLDN11), transcript variant X1, mRNA. ACCESSION XM_025425566 VERSION XM_025425566.3 DBLINK BioProject: PRJNA477859 KEYWORDS RefSeq. SOURCE Canis lupus dingo (dingo) ORGANISM Canis lupus dingo Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_064276) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jul 15, 2022 this sequence version replaced XM_025425566.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Canis lupus dingo Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..885 /organism="Canis lupus dingo" /mol_type="mRNA" /isolate="Sandy" /sub_species="dingo" /db_xref="taxon:286419" /chromosome="34" /sex="female" /tissue_type="muscle" gene 1..885 /gene="CLDN11" /note="claudin 11; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 Proteins" /db_xref="GeneID:112645951" CDS 119..742 /gene="CLDN11" /codon_start=1 /product="claudin-11 isoform X1" /protein_id="XP_025281351.1" /db_xref="GeneID:112645951" /translation="
MVATCLQVVGFVTSFVGWIGIIVTTSTNDWVVTCGYTIPTCRKLDELGSKGLWADCVMATGLYHCKPLVDILILPGYVQACRALMIAASVLGLPAILLLLTVLPCIRMGHEPGVAKYRRAQLAGVMLILLALCAIVATIWFPVCAHRETTIVSFGYSLYAGWIGAVLCLVGGCVIVCCAGDAQAFGENRFYYSSGSSSPTHAKSAHV"
misc_feature 134..634 /gene="CLDN11" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:451326" ORIGIN
gcccagccgtcgcggtcgagccgggccgcagcctcccacgtccgccgtcgcgagcgcagtccccggcgcgggcacagctgctggggcgagccccggggacgccggggtggcggccacgatggtggccacgtgcctgcaggtcgtgggcttcgtcacgagcttcgtgggctggatcggcatcatcgtcaccacgtccaccaacgactgggtggtcacctgcggctacaccatccccacctgccgcaagctggacgaactgggctccaaggggctgtgggccgactgcgtcatggccacggggctgtaccactgcaagcccctggtggacatcctcatcctgccgggctatgtgcaggcctgccgagccctgatgatcgcagcttcggtcctggggctgccggccattctcctgctgctgacggttctcccctgcattcgaatgggccatgagcccggtgtggccaagtacaggcgggcccagctggctggcgtcatgctcattctgctggctctctgtgccatcgtggcgaccatctggttcccggtgtgcgcccaccgcgagaccaccatcgtgagcttcggctactccctgtacgcgggctggatcggggccgtgctgtgcctcgtgggcggctgtgtcatcgtctgctgcgccggggacgcccaggcctttggtgaaaaccgtttctactactcctcgggctccagctcgcccactcatgccaagagtgcccacgtatagagggctccggcctgaccgcggagctgctgcgggtcccgggcccgcggccctagagtcgctgcccggcgggggaggcccctgggctgccaggctccaaagccaaagttctagaaaagcatccggtctggcatgttttagtcttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]