2025-07-03 14:10:00, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_021383796 2454 bp mRNA linear VRT 07-JUN-2017 DEFINITION PREDICTED: Numida meleagris zinc finger protein 252-like (LOC110391848), partial mRNA. ACCESSION XM_021383796 VERSION XM_021383796.1 DBLINK BioProject: PRJNA383663 KEYWORDS RefSeq; includes ab initio. SOURCE Numida meleagris (helmeted guineafowl) ORGANISM Numida meleagris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Numididae; Numida. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_018364764.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Numida meleagris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 20% of CDS bases ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..2454 /organism="Numida meleagris" /mol_type="mRNA" /isolate="19003" /db_xref="taxon:8996" /chromosome="Unknown" /sex="male" /tissue_type="Blood" /breed="g44 Domestic line" gene 1..>2454 /gene="LOC110391848" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 67% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:110391848" CDS 1..>2454 /gene="LOC110391848" /codon_start=1 /product="zinc finger protein 252-like" /protein_id="XP_021239471.1" /db_xref="GeneID:110391848" /translation="
MHSESSLRQRRSLRSGFPAPRPARGWALLRSLLLLALCRPVLRPPRPPHRHNPNVSFIFVRFTAWHYVGCDRLWAGLVSALCRAVRLRFGPWPLAVFHVAGVPPRFGPGRRDWEPRAGACLKLGALGLLLAAGLGLLAAAAAAPWLREHRALNAAGAALSSASGSGLLAAVVAVLRRAAIGERRRLERLAAGESFAEQLGFMSKVRAELEELARFLAAMEVCEGRRLRVVLQISALERCGAERCAGVLEALNTLLADPRAPFVSVLAADPGVVVPCLESSGALHGVGGNAYVYLRRTVSLPFSLPRMDTADRIGALRARLGERDGAGERELQRNQRAGQRGERARNGNQRAGHGNQRAGEHPLSYNEHPSLHGEHPSPSNEHPLSCNEHPSLHGEHPLSCKEHPSPYNHHPLHHHEHPLHLGEHPSPSSEHPSPHGEHPLYTGEHPSPCNEHPLPHGEHPHHGGHPSPHSHHPVHCSEHPLHLGEHPSPCSEHPLSYNEHPSTHGEHPAQHEEHPVHHGEHPPHGEHPLSCNEHPLPHGEHPSPSNEHPLSCSEHPSPYNHHPLHHHEHPLHLGEHPAPSSEHPLHHGEHPSPCNEHPLHHGGHPSPCKEHPSPYNHHPLHCSEHPLHLGEHPAPSSEHPLHHGGHPSSCNEHPLHHGEHPVPSNEHPSPYNHHPSHCSEHPLHHGEHPAPLGEHPPHGEHPLSCSEHPSPYNHHPLHHHEHPLHLGEHPSPSSEHPSPHGEHPSHGEHPSPHGERPWVRFGAARARRFVRAALRSLHDPAEPLSRYVPADGAQLRRLLNTVPITVRLLLHRCAAGGQ"
misc_feature <556..954 /gene="LOC110391848" /note="KAP family P-loop domain; Region: KAP_NTPase; cl46386" /db_xref="CDD:480726" misc_feature <1342..>2145 /gene="LOC110391848" /note="Atrophin-1 family; Region: Atrophin-1; pfam03154" /db_xref="CDD:460830" ORIGIN
atgcactccgagtcctccctccggcagcgccgttctctccgctccggtttccccgctccccgtcccgcccgtggctgggctctgctccgctccctgcttctccttgctctgtgccgcccggtcctgcgtcccccccgccccccgcaccgccacaaccccaacgtctccttcatcttcgtgcgcttcacggcttggcattacgtgggctgcgatcgcctttgggccgggctggtcagcgccctgtgccgagccgtccgcctccgcttcggcccgtggcccttggccgtgttccacgtggccggggtccccccccgcttcggtccgggccgtcgggattgggagccccgagcgggcgcctgcctgaagctgggagcgctggggctgctcctggccgcggggctggggctgctggcggcggccgcggccgctccgtggctccgcgaacaccgggcgctgaacgcggccggggcggctctgagctccgcgtccggttcggggctcctggccgcggtcgtggccgtgctccgccgggcggcgatcggagaacggcgccgtttggagcggctggcggccggggagagcttcgcggagcagctgggtttcatgagcaaagtgcgggcggagctggaggagctggcccggttcctggcggccatggaggtgtgcgaggggaggcggctccgcgtggtgctgcagatctcggcgctggaacgttgcggggccgagcgctgcgcgggggtcctggaagcgctgaacacgctgctggccgatccccgagccccgttcgtctccgtgctggccgccgatcccggcgtcgtcgtgccgtgcctcgagagctccggagcgttgcacggggtgggaggcaacgcttacgtgtacctgcggcggaccgtcagcctgcccttctccctgccacgcatggacacggcggacaggatcggggcgctgagagcgcggctcggggaacgggacggcgccggggaacgggagctgcaacgcaaccagcgggcagggcagcgcggggagcgggcgaggaacggcaaccagcgggcagggcacggcaaccagcgggcaggcgagcacccattgtcctacaatgagcacccatcgctccatggggagcacccatcacccagcaatgagcacccattgtcctgcaatgagcacccatcgctccatggggagcacccattgtcctgcaaggagcacccatcaccctacaaccatcacccactgcatcaccatgagcacccactgcacctcggggagcacccatcacccagcagtgagcacccatcgccccacggggagcacccattgtacaccggggagcacccatcaccctgcaatgagcacccattgccccacggggagcacccacaccatggggggcacccatcgccccacagccatcacccagtgcactgcagcgagcacccactgcacctcggggagcacccatcgccctgcagtgagcacccattgtcctacaatgagcacccatcaacccacggggagcacccagcacagcacgaggagcacccagtgcaccatggggagcacccaccccacggggagcacccattgtcctgcaatgagcacccactgccccatggggagcacccatcacccagcaatgagcacccattgtcctgcagtgagcacccatcgccctacaaccatcacccattgcaccaccatgagcacccactgcacctcggggagcacccagcgcccagcagtgagcacccattgcaccatggggagcacccatcaccctgcaatgagcacccattgcaccatggggggcacccatcgccctgcaaggagcacccatcgccctacaaccatcacccattgcactgcagtgagcacccactgcacctcggggagcacccagcgcccagcagtgagcacccattgcaccatgggggacacccatcgtcctgcaatgagcacccattgcaccatggggagcacccagtgcccagcaatgagcacccatcgccctacaaccatcacccatcgcactgcagcgagcacccactgcaccatggggagcacccagcgcccctcggggagcacccaccccacggggagcacccattgtcctgcagtgagcacccatcaccctacaaccatcacccactgcatcaccatgagcacccactgcacctcggggagcacccatcgcccagcagtgagcacccatcgccccacggggagcacccatcccacggggagcacccatccccccacggggagcgcccttgggtgcgtttcggggcggcccgtgcccggcgcttcgtgcgggcggcgctgcgctccctgcacgaccccgcggagccgctgtcccgttacgtccccgccgacggcgcccagctccgccgcctgctcaacaccgtccccatcaccgtgcgactcctgctgcaccgctgcgccgccggggggcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]