GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-06-08 03:05:14, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_018881852             846 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Gpi11p (GPI11), partial mRNA.
ACCESSION   XM_018881852
VERSION     XM_018881852.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 846)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 846)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 846)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031672).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..846
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="A"
     gene            <1..>846
                     /gene="GPI11"
                     /locus_tag="AWJ20_476"
                     /db_xref="GeneID:30036926"
     CDS             1..846
                     /gene="GPI11"
                     /locus_tag="AWJ20_476"
                     /inference="similar to AA sequence:KEGG_Orthology:K05287"
                     /note="ER membrane protein involved in a late step of GPI
                     anchor assembly; involved in the addition of
                     phosphoethanolamine to the multiply mannosylated
                     glycosylphosphatidylinositol (GPI) intermediate; human
                     PIG-Fp is a functional homolog; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IEA]; GO_component:
                     GO:0005783 - endoplasmic reticulum [Evidence ISS] [PMID
                     10793139]; GO_component: GO:0005789 - endoplasmic
                     reticulum membrane [Evidence IEA,IEA]; GO_component:
                     GO:0005789 - endoplasmic reticulum membrane [Evidence IC]
                     [PMID 10793139]; GO_component: GO:0016021 - integral
                     component of membrane [Evidence IEA,IEA]; GO_component:
                     GO:0016021 - integral component of membrane [Evidence ISM]
                     [PMID 12192589]; GO_component: GO:0016020 - membrane
                     [Evidence IEA]; GO_function: GO:0051377 -
                     mannose-ethanolamine phosphotransferase activity [Evidence
                     IMP] [PMID 10793139]; GO_process: GO:0006506 - GPI anchor
                     biosynthetic process [Evidence IEA,IEA,IEA]; GO_process:
                     GO:0006506 - GPI anchor biosynthetic process [Evidence
                     IMP] [PMID 10793139]"
                     /codon_start=1
                     /product="Gpi11p"
                     /protein_id="XP_018734704.1"
                     /db_xref="GeneID:30036926"
                     /translation="
MPKSKTNGAVVSGSSGSGSPAGNGRQSSPVPGKPAVLGKSGSSGSSSSNGKSSAASLAASVTYAVTLLAYFWYTLTQGTLVTDPVRTLTETTLALVLIQIVYCAAGLDDQSGLHSTSTKSKQPKTDSGISSRISVSALLSQLESIIFTNKLQTAILATILSLAMSVLVFGLLILFGAPVTSHIPETFLCAVHISILSVQPLVFVYKLDSKIWKDIVSVKLPLNGVYGASVGTWLGAWLGAVPIPLDWDRPWQRWPVTIVAGAYFGTALGTLIGALYRQIRH"
     misc_feature    184..819
                     /gene="GPI11"
                     /locus_tag="AWJ20_476"
                     /note="GPI biosynthesis protein family Pig-F; Region:
                     PIG-F; pfam06699"
                     /db_xref="CDD:461990"
ORIGIN      
atgcctaaatcaaagaccaatggcgctgttgtcagtggcagcagtggatcagggtcgccggctggtaatggccgtcagagctcgccagttcctggaaaaccagcagttttagggaaatccgggtcttccggtagcagcagcagcaatggcaagtcttcagctgcttcgttagcagcatccgtgacctatgccgtcactttattagcatatttctggtacactttgacccagggaactctagtgaccgatccagtacgaactctgactgagactactctggctctggtgctcattcaaattgtttactgtgcagcaggactcgacgaccagtctggactccactcaacttcgaccaaatccaaacaacccaagactgattctggaatctccagtagaatctctgtaagtgctctactttcacaactggaatcaattatttttactaacaaattacagacggccattttggcgactattctcagtctggcgatgtcagttctggtattcggactcctgattctgttcggagctcctgtcacttcacacattcccgagacgtttctgtgtgccgttcacatctcgatcctgtcagtgcaaccgctcgtgtttgtatataaactggactccaagatctggaaagacattgtctcggtcaaactaccactgaatggcgtctatggagcatccgtcggcacgtggctcggagcgtggctcggcgctgtccccattcctcttgactgggaccgaccctggcaacgctggcccgtcaccatcgtggccggagcctacttcggcaccgccctcggcaccctcatcggcgctctctaccgccagattagacactag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]