2025-07-15 21:04:04, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_018881652 873 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans ADP/ATP carrier protein PET9 (PET9), partial mRNA. ACCESSION XM_018881652 VERSION XM_018881652.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 873) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 873) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 873) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031671). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..873 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="C" gene <1..>873 /gene="PET9" /locus_tag="AWJ20_4572" /db_xref="GeneID:30036719" CDS 1..873 /gene="PET9" /locus_tag="AWJ20_4572" /inference="similar to AA sequence:KEGG_Orthology:K05863" /note="Major ADP/ATP carrier of the mitochondrial inner membrane; exchanges cytosolic ADP for mitochondrially synthesized ATP; also imports heme and ATP; phosphorylated; required for viability in many lab strains that carry a sal1 mutation; PET9 has a paralog, AAC3, that arose from the whole genome duplication; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_component: GO:0005743 - mitochondrial inner membrane [Evidence IEA,IEA,IEA]; GO_component: GO:0005743 - mitochondrial inner membrane [Evidence IDA] [PMID 795470]; GO_component: GO:0005739 - mitochondrion [Evidence IEA]; GO_component: GO:0005739 - mitochondrion [Evidence IDA] [PMID 16823961]; GO_component: GO:0005739 - mitochondrion [Evidence IPI] [PMID 16962558]; GO_function: GO:0005471 - ATP:ADP antiporter activity [Evidence IDA] [PMID 8476415]; GO_function: GO:0005215 - transporter activity [Evidence IEA]; GO_process: GO:0015866 - ADP transport [Evidence IDA] [PMID 8476415]; GO_process: GO:0015867 - ATP transport [Evidence IDA] [PMID 8476415]; GO_process: GO:0009060 - aerobic respiration [Evidence IMP] [PMID 2167309]; GO_process: GO:0009061 - anaerobic respiration [Evidence IGI] [PMID 1915842]; GO_process: GO:0006915 - apoptotic process [Evidence IMP] [PMID 17822411]; GO_process: GO:0015886 - heme transport [Evidence IMP,IPI] [PMID 18728780]; GO_process: GO:0006839 - mitochondrial transport [Evidence IMP] [PMID 2167309]; GO_process: GO:0055085 - transmembrane transport [Evidence IEA]; GO_process: GO:0055085 - transmembrane transport [Evidence IDA] [PMID 8476415]; GO_process: GO:0006810 - transport [Evidence IEA,IEA]" /codon_start=1 /product="ADP/ATP carrier protein PET9" /protein_id="XP_018734227.1" /db_xref="GeneID:30036719" /translation="
MGGVSAAVAKTAAAPIERVKLLIQNQDEMIKQGRLARKYDGIADAFRRTAAEEGIVSFWRGNTANVIRYFPTQALNFAFKDKFKALFGFKKSEGYWPWFAGNLASGGLAGATSLLFVYSLDYARTRLANDAKAAKGGGDREFNGLVDVYRKTLKSDGIAGLYRGFGPSVVGIIVYRGLYFGLYDSLKPVVLVGSLEGNFLASFLLGWTVTTGASTASYPLDTVRRRMMMTSGQAVKYKSSFDAFTKIVAAEGVTSLFKGCGANILRGVAGAGVISMYDQLQMILFGKKFK"
misc_feature 1..852 /gene="PET9" /locus_tag="AWJ20_4572" /note="ADP/ATP transporter on adenylate translocase; Provisional; Region: PTZ00169" /db_xref="CDD:240302" ORIGIN
atgggaggtgtgtccgccgccgtcgctaagaccgccgctgcccccatcgagcgtgttaagcttcttatccaaaaccaagatgagatgatcaagcaaggtcgtcttgccagaaagtacgatggtattgccgatgctttccgtcgtactgctgctgaggaaggtattgtctctttctggagaggtaacactgctaacgttatccgttacttccccacccaagcccttaactttgccttcaaggataagttcaaggctctcttcggtttcaagaagtccgagggttactggccttggttcgccggtaacttggcttctggtggtcttgccggtgccacttctcttctcttcgtctactctcttgattacgcccgtactcgtcttgccaacgatgccaaggctgccaagggtggcggtgaccgtgagttcaacggtttggtcgatgtttacagaaagactctcaagtctgacggtattgccggtctctaccgtggtttcggtccctctgttgtcggtatcattgtctaccgtggtctttacttcggtctttacgattctcttaagcctgttgttcttgtcggttctcttgagggtaacttcttggcctctttcttgcttggttggaccgtcaccactggtgcctctactgcttcttatcctttggataccgtccgtcgtcgtatgatgatgacctctggtcaagccgttaagtacaagtcctctttcgacgctttcaccaagattgtcgccgctgagggtgttacttctctcttcaagggatgcggtgccaacattctccgtggtgttgccggtgctggtgttatctccatgtacgatcaattgcaaatgatcctcttcggtaagaagttcaaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]