GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:08:37, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_018881312            1059 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Sec20p (SEC20), partial mRNA.
ACCESSION   XM_018881312
VERSION     XM_018881312.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 1059)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1059)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1059)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031671).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1059
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="C"
     gene            <1..>1059
                     /gene="SEC20"
                     /locus_tag="AWJ20_4248"
                     /db_xref="GeneID:30036359"
     CDS             1..1059
                     /gene="SEC20"
                     /locus_tag="AWJ20_4248"
                     /inference="similar to AA sequence:KEGG_Orthology:K08497"
                     /note="Membrane glycoprotein v-SNARE; involved in
                     retrograde transport from the Golgi to the endoplasmic
                     reticulum (ER); required for N- and O-glycosylation in the
                     Golgi but not in the ER; interacts with the Dsl1p complex
                     through Tip20p; GO_component: GO:0031201 - SNARE complex
                     [Evidence IDA] [PMID 12853481]; GO_component: GO:0031201 -
                     SNARE complex [Evidence IDA] [PMID 12893879];
                     GO_component: GO:0031201 - SNARE complex [Evidence IDA]
                     [PMID 9214619]; GO_component: GO:0005783 - endoplasmic
                     reticulum [Evidence IEA]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IDA] [PMID 11914276];
                     GO_component: GO:0005783 - endoplasmic reticulum [Evidence
                     IDA] [PMID 8334998]; GO_component: GO:0005789 -
                     endoplasmic reticulum membrane [Evidence IEA];
                     GO_component: GO:0016021 - integral component of membrane
                     [Evidence IEA]; GO_component: GO:0016021 - integral
                     component of membrane [Evidence IDA,ISM] [PMID 1537327];
                     GO_component: GO:0016020 - membrane [Evidence IEA];
                     GO_component: GO:0005777 - peroxisome [Evidence IDA] [PMID
                     19346454]; GO_function: GO:0005484 - SNAP receptor
                     activity [Evidence ISM] [PMID 12853481]; GO_function:
                     GO:0005484 - SNAP receptor activity [Evidence ISM] [PMID
                     12893879]; GO_process: GO:0015031 - protein transport
                     [Evidence IEA]; GO_process: GO:0006890 - retrograde
                     vesicle-mediated transport, Golgi to ER [Evidence IMP]
                     [PMID 8612273]; GO_process: GO:0006810 - transport
                     [Evidence IEA]; GO_process: GO:0048279 - vesicle fusion
                     with endoplasmic reticulum [Evidence IC] [PMID 8612273];
                     GO_process: GO:0048279 - vesicle fusion with endoplasmic
                     reticulum [Evidence NAS] [PMID 9214619]; GO_process:
                     GO:0016192 - vesicle-mediated transport [Evidence IEA]"
                     /codon_start=1
                     /product="Sec20p"
                     /protein_id="XP_018733915.1"
                     /db_xref="GeneID:30036359"
                     /translation="
MTIEEAITRQLDSYHLLLELITRLHTLSSSKEVRQELADLIQRRIKEYDTATESLEIQIENHVSQTDPNRKRYLVSLDRIRENLRLAKVRFRKAQIQSKKNTELAWIKERELIFRPPREDDKSKSSTNGHSKDSGGSGKRELSTQDMLVSKSEDITAKLRHVHQMAQTEVVKSSLNIDELDYSTKTLRELEHKYSAFDVMLNGSQRLVRHLEEADKWDRIYMLASLGFLALVVAWILWRRIFKAPTMLVLWVMLKFFRLVRPSPSDIVNAKSSIFTAPVAETQEIAASAVSSSSELASASGTVLDSISSVTETADELIETLASVLSEAVSTAAETLLAATNRAEPLPVHNDL"
     misc_feature    448..723
                     /gene="SEC20"
                     /locus_tag="AWJ20_4248"
                     /note="Region: Sec20; pfam03908"
                     /db_xref="CDD:112708"
ORIGIN      
atgacaattgaagaggccattacgcggcaattggacagttaccatctgcttttagaactaataacgagacttcacaccctgtcgagctctaaggaggttcgtcaggagctggcagatctaattcagaggcggatcaaagaatatgatacagcgacggaatcattggaaattcaaattgaaaatcatgttagccaaacagacccaaatagaaaaagatacttggtctccttagataggatacgagagaacctacggcttgccaaagtaaggttcagaaaagcgcaaatacaatccaagaaaaatacagaacttgcatggataaaagagagagagctgatattcaggccacccagagaagatgacaagtctaaatcgtcaacaaatgggcatagcaaagatagcggtggcagtggcaaacgagaactaagcactcaagacatgctagttagcaaatcagaagatatcactgccaagctccgacatgtccatcaaatggcacagaccgaggtggtgaaatcgtcattaaatatagacgagctcgactactcgacaaaaacactacgagaactggaacataaatactcagctttcgacgtcatgctgaatggatcacagcgactagttcgccacctcgaagaagccgataaatgggacagaatctacatgcttgcctcactcgggttcctggctctcgtagtggcatggatcctatggcgtcgtattttcaaggctccaacaatgctcgttctttgggtcatgctaaaattcttccgtttagtacgtccttctcccagcgatattgtaaatgctaagtcaagtatattcacagcaccggtcgccgagacccaagaaattgctgcttcagctgtatcctcttcctcggaacttgcatccgcttctggaacagtacttgattccatttcttctgtcaccgaaactgcagacgagctcatcgaaacacttgcttccgtactctcagaagcggtctcaacagccgccgagaccctgttagctgctactaacagagctgagccacttcccgtacataatgatttatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]