2025-04-04 14:08:37, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_018881312 1059 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Sec20p (SEC20), partial mRNA. ACCESSION XM_018881312 VERSION XM_018881312.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 1059) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 1059) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1059) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031671). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1059 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="C" gene <1..>1059 /gene="SEC20" /locus_tag="AWJ20_4248" /db_xref="GeneID:30036359" CDS 1..1059 /gene="SEC20" /locus_tag="AWJ20_4248" /inference="similar to AA sequence:KEGG_Orthology:K08497" /note="Membrane glycoprotein v-SNARE; involved in retrograde transport from the Golgi to the endoplasmic reticulum (ER); required for N- and O-glycosylation in the Golgi but not in the ER; interacts with the Dsl1p complex through Tip20p; GO_component: GO:0031201 - SNARE complex [Evidence IDA] [PMID 12853481]; GO_component: GO:0031201 - SNARE complex [Evidence IDA] [PMID 12893879]; GO_component: GO:0031201 - SNARE complex [Evidence IDA] [PMID 9214619]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 11914276]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 8334998]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IDA,ISM] [PMID 1537327]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_component: GO:0005777 - peroxisome [Evidence IDA] [PMID 19346454]; GO_function: GO:0005484 - SNAP receptor activity [Evidence ISM] [PMID 12853481]; GO_function: GO:0005484 - SNAP receptor activity [Evidence ISM] [PMID 12893879]; GO_process: GO:0015031 - protein transport [Evidence IEA]; GO_process: GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence IMP] [PMID 8612273]; GO_process: GO:0006810 - transport [Evidence IEA]; GO_process: GO:0048279 - vesicle fusion with endoplasmic reticulum [Evidence IC] [PMID 8612273]; GO_process: GO:0048279 - vesicle fusion with endoplasmic reticulum [Evidence NAS] [PMID 9214619]; GO_process: GO:0016192 - vesicle-mediated transport [Evidence IEA]" /codon_start=1 /product="Sec20p" /protein_id="XP_018733915.1" /db_xref="GeneID:30036359" /translation="
MTIEEAITRQLDSYHLLLELITRLHTLSSSKEVRQELADLIQRRIKEYDTATESLEIQIENHVSQTDPNRKRYLVSLDRIRENLRLAKVRFRKAQIQSKKNTELAWIKERELIFRPPREDDKSKSSTNGHSKDSGGSGKRELSTQDMLVSKSEDITAKLRHVHQMAQTEVVKSSLNIDELDYSTKTLRELEHKYSAFDVMLNGSQRLVRHLEEADKWDRIYMLASLGFLALVVAWILWRRIFKAPTMLVLWVMLKFFRLVRPSPSDIVNAKSSIFTAPVAETQEIAASAVSSSSELASASGTVLDSISSVTETADELIETLASVLSEAVSTAAETLLAATNRAEPLPVHNDL"
misc_feature 448..723 /gene="SEC20" /locus_tag="AWJ20_4248" /note="Region: Sec20; pfam03908" /db_xref="CDD:112708" ORIGIN
atgacaattgaagaggccattacgcggcaattggacagttaccatctgcttttagaactaataacgagacttcacaccctgtcgagctctaaggaggttcgtcaggagctggcagatctaattcagaggcggatcaaagaatatgatacagcgacggaatcattggaaattcaaattgaaaatcatgttagccaaacagacccaaatagaaaaagatacttggtctccttagataggatacgagagaacctacggcttgccaaagtaaggttcagaaaagcgcaaatacaatccaagaaaaatacagaacttgcatggataaaagagagagagctgatattcaggccacccagagaagatgacaagtctaaatcgtcaacaaatgggcatagcaaagatagcggtggcagtggcaaacgagaactaagcactcaagacatgctagttagcaaatcagaagatatcactgccaagctccgacatgtccatcaaatggcacagaccgaggtggtgaaatcgtcattaaatatagacgagctcgactactcgacaaaaacactacgagaactggaacataaatactcagctttcgacgtcatgctgaatggatcacagcgactagttcgccacctcgaagaagccgataaatgggacagaatctacatgcttgcctcactcgggttcctggctctcgtagtggcatggatcctatggcgtcgtattttcaaggctccaacaatgctcgttctttgggtcatgctaaaattcttccgtttagtacgtccttctcccagcgatattgtaaatgctaagtcaagtatattcacagcaccggtcgccgagacccaagaaattgctgcttcagctgtatcctcttcctcggaacttgcatccgcttctggaacagtacttgattccatttcttctgtcaccgaaactgcagacgagctcatcgaaacacttgcttccgtactctcagaagcggtctcaacagccgccgagaccctgttagctgctactaacagagctgagccacttcccgtacataatgatttatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]