2025-07-15 21:05:27, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_018881183 1977 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Aim14p (AIM14), partial mRNA. ACCESSION XM_018881183 VERSION XM_018881183.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 1977) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 1977) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1977) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031671). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1977 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="C" gene <1..>1977 /gene="AIM14" /locus_tag="AWJ20_4125" /db_xref="GeneID:30036223" CDS 1..1977 /gene="AIM14" /locus_tag="AWJ20_4125" /note="NADPH oxidase localized to the perinuclear ER; produces superoxide from NADPH; overexpression causes MCA1 dependent apoptosis; likely involved in superoxide-mediated regulation of the actin cytoskeleton; member of a conserved superfamily of NADPH oxidases (NOX enzymes); has similarity to iron/copper reductases (FRE1-8), particularly Fre8p; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 10341420]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0016020 - membrane [Evidence IEA,IEA]; GO_component: GO:0097038 - perinuclear endoplasmic reticulum [Evidence IDA] [PMID 22586098]; GO_component: GO:0005840 - ribosome [Evidence IDA] [PMID 16702403]; GO_function: GO:0000293 - ferric-chelate reductase activity [Evidence IMP] [PMID 22586098]; GO_function: GO:0016491 - oxidoreductase activity [Evidence IEA,IEA]; GO_function: GO:0016722 - oxidoreductase activity, oxidizing metal ions [Evidence ISA] [PMID 10341420]; GO_function: GO:0016175 - superoxide-generating NADPH oxidase activity [Evidence IMP] [PMID 22586098]; GO_process: GO:0006915 - apoptotic process [Evidence IGI] [PMID 22586098]; GO_process: GO:0006811 - ion transport [Evidence IEA]; GO_process: GO:0055114 - oxidation-reduction process [Evidence IEA,IEA]; GO_process: GO:0032956 - regulation of actin cytoskeleton organization [Evidence IMP] [PMID 22586098]" /codon_start=1 /product="Aim14p" /protein_id="XP_018733798.1" /db_xref="GeneID:30036223" /translation="
MDAVVLSVLQARHEGHHDEVPSPVIPGGNAHHGAHYANITYGYILVLISIIGMVWISVTNTINIRSAGAGVSGLTGGISGLSRKLSDISLRGFRLGHLLSKPSPRLVLLPLWILVVALLSLTGGATGSLNGLAKRLGRITFAIVPLILFLSLKPSPLPNTYYVKLLTFHKWIARSAVLTGSLHGILYTAYFIRQGTTVKILKVDNLLGVVLLLGFLVVFITSLRPIRTRYYRLFYALHYPLAWVFLIIASFHARPGVGFLALWSAFILLGQAFYRVFTSRTIRIIENYQVSPTLYSVTLPRDIMPDYFPAGSHIRLGKRSLWSPLSWLEPTHPYTIASLSSDEANIRLLIRKTNFTIQNGVHYTISGPFASRIAQELSPSTSSSSDGGADSGVGYKAVGDGARKVVVFAGGSGLSFAAPLVRELSSMGIAYRLIWITRDKTDLKALELLEISAADVYITGNNPNSSSNVYSDILDRGNEFNLNLSSGLSALKSVSSAAATVASGGRTRGVNTSTTGYNDYEEEIEFDELVESDPELSSSTSTHDDDDTPLEPATPSDASSSSSSSNNTRSKRRSNTNLSDTSRANTNFNSTKPPTSSFARITITYGRPDFSQSTSTFILPGQQRSSWAIACGPKQLVHDVETWATANHISFSGEKYFL"
misc_feature 406..747 /gene="AIM14" /locus_tag="AWJ20_4125" /note="Ferric reductase like transmembrane component; Region: Ferric_reduct; pfam01794" /db_xref="CDD:426438" misc_feature 889..1380 /gene="AIM14" /locus_tag="AWJ20_4125" /note="NADPH oxidase (NOX) catalyzes the generation of reactive oxygen species (ROS) such as superoxide and hydrogen peroxide. ROS were originally identified as bactericidal agents in phagocytes, but are now also implicated in cell signaling and metabolism. NOX...; Region: NOX_Duox_like_FAD_NADP; cd06186" /db_xref="CDD:99783" misc_feature order(937..939,994..1005,1045..1053,1063..1068,1234..1236) /gene="AIM14" /locus_tag="AWJ20_4125" /note="FAD binding pocket [chemical binding]; other site" /db_xref="CDD:99783" misc_feature order(994..996,1000..1005) /gene="AIM14" /locus_tag="AWJ20_4125" /note="FAD binding motif [chemical binding]; other site" /db_xref="CDD:99783" misc_feature 1219..1251 /gene="AIM14" /locus_tag="AWJ20_4125" /note="NAD pyrophosphate binding region [chemical binding]; other site" /db_xref="CDD:99783" misc_feature order(1219..1221,1231..1242,1246..1248) /gene="AIM14" /locus_tag="AWJ20_4125" /note="beta-alpha-beta stucture motif; other site" /db_xref="CDD:99783" misc_feature order(1300..1305,1312..1314) /gene="AIM14" /locus_tag="AWJ20_4125" /note="NADP ribose binding motif [chemical binding]; other site" /db_xref="CDD:99783" ORIGIN
atggacgcggtggtgctgagtgtgctgcaagcgcgacacgaggggcatcacgacgaggtgcccagtcctgtcattcccggtggaaacgcccatcatggcgctcactatgctaatatcacttatgggtacattcttgtgctgatatctataattggcatggtatggataagtgtcacgaacactataaacatcaggtcagccggagcaggcgtgtctgggttgactggaggaatttcaggtctgtcaaggaagctgtcggacatttcgctaaggggattcagacttggtcatttactctccaaaccatctcctagattagtccttttgccattatggatcctggtagtggctttattatcacttactggtggagctacagggtcactgaatggactggcaaaacggttgggaagaattacgttcgcaatagtaccgctgattctgttcttgtcactcaaaccgtcaccattacctaatacatattatgtcaagctactgacttttcataaatggatcgctagaagtgctgtattaacaggctcgctccatgggatcctgtacacagcatactttattagacagggaaccacagtcaagatcctcaaagtggataatttactgggagtagtgttactactagggtttttggtggtgtttattacttcgttaagacctattcgaacaagatactatagactattttacgcgctccattatccattggcatgggttttcttgataatagccagtttccatgctcgtccaggagttgggtttctagctctttggtcggcatttatcctgctgggccaggccttttatagagtgtttacctcacgaacaattcgcatcattgaaaactatcaggtatcaccaaccctgtattcagtcacgcttccacgagatataatgcctgattacttcccagcaggttcgcatattagactgggtaaacgaagtctgtggtcacctttgtcatggcttgagcctactcatccgtataccattgcatctctgtcatcagacgaggccaatatcagacttttgatccggaaaacaaacttcactattcaaaatggagttcattatacgatttcaggaccgtttgcgagcaggatagctcaagagctcagtccatccaccagttccagttcggatggtggtgctgattcgggtgttgggtataaagcagtaggagatggagctcgtaaagtagtagtatttgctgggggttcaggactgtcatttgcagcaccacttgttcgtgaactgagttccatgggtattgcctaccgtcttatctggataacccgtgacaaaactgatctcaaggctctcgaactgcttgaaatcagtgctgccgatgtgtatatcacaggtaataaccccaacagctcttctaacgtctacagcgacattctggaccgtggtaatgagttcaacttgaacctttcttctggtctttcagcactgaaatcagtctcttcagcagcagccactgttgctagcggaggtcgaactcgcggtgtcaataccagcacgactggatacaatgactatgaagaagaaatagaattcgatgagctcgtggaatcagaccctgaactttcgtcatcaacctcgactcatgacgacgacgacactccactggaacctgccacccccagcgacgccagctcgtcgtcctcttcatccaacaacacacgatccaaacgacgatctaacaccaacctctccgataccagccgagcaaacaccaacttcaactcgacaaaaccccctacaagctcgtttgctcgaatcacaattacctacggccgacccgacttctcccaatccacaagcacattcatacttcccggccaacaacgctcctcctgggccatagcctgcggtcccaaacagctcgtccacgacgtcgagacctgggccactgccaaccacatttccttctccggcgaaaagtacttcctataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]