2025-06-08 02:33:55, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_018881096 951 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Pfa4p (PFA4), partial mRNA. ACCESSION XM_018881096 VERSION XM_018881096.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 951) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 951) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 951) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031671). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..951 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="C" gene <1..>951 /gene="PFA4" /locus_tag="AWJ20_4046" /db_xref="GeneID:30036135" CDS 1..951 /gene="PFA4" /locus_tag="AWJ20_4046" /inference="similar to AA sequence:KEGG_Orthology:K18932" /note="Palmitoyltransferase with autoacylation activity; required for palmitoylation of amino acid permeases containing a C-terminal Phe-Trp-Cys site; required for modification of Chs3p; member of the DHHC family of putative palmitoyltransferases; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 16647879]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_function: GO:0046872 - metal ion binding [Evidence IEA]; GO_function: GO:0016409 - palmitoyltransferase activity [Evidence IMP] [PMID 16818716]; GO_function: GO:0019706 - protein-cysteine S-palmitoyltransferase activity [Evidence IEA]; GO_function: GO:0016740 - transferase activity [Evidence IEA]; GO_function: GO:0016746 - transferase activity, transferring acyl groups [Evidence IEA]; GO_function: GO:0008270 - zinc ion binding [Evidence IEA]; GO_process: GO:0018345 - protein palmitoylation [Evidence IMP] [PMID 16751107]; GO_process: GO:0018345 - protein palmitoylation [Evidence IMP] [PMID 16818716]" /codon_start=1 /product="Pfa4p" /protein_id="XP_018733720.1" /db_xref="GeneID:30036135" /translation="
MTSPGSPTSDFKPLPGEWTRWCIKCNGYKPERTHHCRQCKKCVLKMDHHCPWTYNCVGHANMPHFVRFLAWVLISASYAFYHVWARGFFLYSKRHLPLSTYDVTKTEIAFTIVLIPVVSFVLFSVGLLSIRVAWNMVEGQTQIETWEVERIETLVRRKLVQNVEFPYDLDPWTNVANAMGGNNPLAWMWPFGGPVGDGMHFEKNEAADDGSVWPPDHRDQGPPRSGSAGASSSPSGDIGIRTAAPRGHYPRTLGYMRHRGNGEYAEDDGDDGYDSDSEDEEVERLPEENDFYKRDQWMNFEGESIADFGVDVDTES"
misc_feature <52..582 /gene="PFA4" /locus_tag="AWJ20_4046" /note="DHHC palmitoyltransferase; Region: DHHC; cl19890" /db_xref="CDD:418707" ORIGIN
atgacctcgccaggaagcccaacatcggatttcaagccgcttcctggtgaatggaccaggtggtgtatcaagtgcaatggttataagcccgaaagaactcatcattgtagacagtgtaagaaatgtgtcttgaagatggaccaccattgtccttggacttataactgcgtgggtcatgccaatatgcctcactttgtgaggttcctagcttgggtgctcatatcggctagttacgcattctatcatgtatgggctagaggcttctttttgtactctaagcggcatcttcctctatcaacttatgatgtgactaaaaccgagattgcatttactattgtattgatcccagtggtttcatttgtcttgttctcagttggcttgctgtccatccgtgtcgcatggaacatggtcgagggtcagactcaaattgaaacatgggaggtcgaacgtattgaaactctcgttcgcagaaaactggtgcaaaatgtcgaatttccgtatgatttagatccgtggactaatgtagctaatgccatgggcggtaataatccgctggcatggatgtggccgtttggtgggcctgttggtgatggtatgcattttgagaaaaatgaggccgctgatgacggctctgtttggccacctgaccatcgagaccagggtcctcctcgttctgggtctgctggagcgtcatcctcgccgtccggggatatcggtataaggacagcggctccacgaggacactatcccagaacactggggtacatgcgccaccgtggtaatggtgagtatgccgaagacgatggagacgatggctatgacagtgattccgaagacgaagaagtcgaacgtcttcctgaagagaacgatttttacaagcgcgatcagtggatgaactttgagggcgagtccatcgccgatttcggtgtcgacgtcgatactgagagctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]