GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:05:15, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_018880969             918 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Say1p (SAY1), partial mRNA.
ACCESSION   XM_018880969
VERSION     XM_018880969.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 918)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 918)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 918)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031671).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..918
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="C"
     gene            <1..>918
                     /gene="SAY1"
                     /locus_tag="AWJ20_3929"
                     /db_xref="GeneID:30036004"
     CDS             1..918
                     /gene="SAY1"
                     /locus_tag="AWJ20_3929"
                     /note="Sterol deacetylase; component of the sterol
                     acetylation/deacetylation cycle along with Atf2p; active
                     both in the endoplasmic reticulum (ER) and in lipid
                     droplets; integral membrane protein with active site in
                     the ER lumen; green fluorescent protein (GFP)-fusion
                     protein localizes to the ER; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IEA]; GO_component:
                     GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID
                     14562095]; GO_component: GO:0005783 - endoplasmic
                     reticulum [Evidence IDA] [PMID 24868093]; GO_component:
                     GO:0005788 - endoplasmic reticulum lumen [Evidence IDA]
                     [PMID 18034159]; GO_component: GO:0005789 - endoplasmic
                     reticulum membrane [Evidence IEA]; GO_component:
                     GO:0016021 - integral component of membrane [Evidence
                     IEA]; GO_component: GO:0016021 - integral component of
                     membrane [Evidence IDA] [PMID 18034159]; GO_component:
                     GO:0005811 - lipid particle [Evidence IDA] [PMID
                     24868093]; GO_component: GO:0016020 - membrane [Evidence
                     IEA]; GO_function: GO:0016787 - hydrolase activity
                     [Evidence IEA]; GO_function: GO:0034084 - steryl
                     deacetylase activity [Evidence IDA,IMP] [PMID 18034159];
                     GO_process: GO:0009636 - response to toxic substance
                     [Evidence IMP] [PMID 18034159]; GO_process: GO:0034210 -
                     sterol deacetylation [Evidence IMP] [PMID 18034159];
                     GO_process: GO:0016125 - sterol metabolic process
                     [Evidence IMP] [PMID 18034159]"
                     /codon_start=1
                     /product="Say1p"
                     /protein_id="XP_018733607.1"
                     /db_xref="GeneID:30036004"
                     /translation="
MPTSAAKVLGWTMKKPFKNYGKKYASDGFTAYWLVELDDRQPEDPVLIFCHGGGFVFPLSLPQVWLLTAIVRAFPSVRLNVLILDYSLSPEHRYPTQIEEIASLYRHLLDVEACENIVLAGESCGGNLILALLAHLKHGFPTASPTTSKCKDTAVKGAILISPWVNLAIEAVVHDADSSYVKNAHEDILNTERLCFWANEYCPDKLTRQTSPWVSPVLLIKENIGFWENVLPARTLITWGEEELMKDDVARFASMTNISNAFEVPNGVHVDVLFQSKSPVYDKIIAFLEGVFEAKSVDSSTSTIL"
     misc_feature    <88..816
                     /gene="SAY1"
                     /locus_tag="AWJ20_3929"
                     /note="A functionally diverse superfamily containing
                     proteases, lipases, peroxidases, esterases, epoxide
                     hydrolases and dehalogenases. The catalytic apparatus
                     typically involves three residues (catalytic triad): a
                     serine, a glutamate or aspartate and a...; Region:
                     alpha/beta hydrolases; cl21494"
                     /db_xref="CDD:473884"
ORIGIN      
atgcctactagtgccgcaaaggttctgggatggacaatgaagaaaccgtttaagaactacggcaaaaagtacgcttcagatggatttactgcttattggctggttgaactggatgatagacaaccagaggatcctgttctgatattctgtcatggaggtggatttgtatttccgctatctcttccccaagtttggttgttgactgctatcgtgagagcattccctagcgtaagattaaacgtcttgatattggactattcattgtcaccagagcatagatacccaacacaaatcgaagaaattgcttctctttatcgccatttgcttgatgttgaggcatgtgagaatattgtgcttgctggtgaatcttgtggaggaaatttgatacttgccttgttagcacatctaaagcatgggtttccgaccgcaagtcccactacaagtaaatgcaaggacactgctgtcaagggagccatactcatatcaccatgggttaatcttgcaatagaagcagttgtccacgatgcagactcttcatatgtaaagaatgctcatgaggatattttaaatactgaacggttatgcttttgggcaaatgagtattgcccagacaaacttacaagacagacgtctccttgggttagccctgtcttattgataaaggaaaacattggcttttgggaaaatgtattaccagcgcgtacgttgatcacctggggagaagaagaacttatgaaagacgatgtagcgcgctttgcgtccatgaccaacataagcaatgcgttcgaagttcccaacggtgttcacgttgatgtattatttcagtcaaagtctcccgtctatgataagataatagcatttctggaaggagtgtttgaagcaaaatctgtcgattctagtactagtactatattatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]