2025-04-04 14:13:34, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_018879510 1392 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Ale1p (ALE1), partial mRNA. ACCESSION XM_018879510 VERSION XM_018879510.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 1392) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 1392) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1392) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031674). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1392 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="B" gene <1..>1392 /gene="ALE1" /locus_tag="AWJ20_2560" /db_xref="GeneID:30034485" CDS 1..1392 /gene="ALE1" /locus_tag="AWJ20_2560" /inference="similar to AA sequence:KEGG_Orthology:K13519" /note="Broad-specificity lysophospholipid acyltransferase; part of MBOAT family of membrane-bound O-acyltransferases; key component of Lands cycle; may have role in fatty acid exchange at sn-2 position of mature glycerophospholipids; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 14562095]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 17890783]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0043231 - intracellular membrane-bounded organelle [Evidence IEA]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_component: GO:0031090 - organelle membrane [Evidence IEA]; GO_component: GO:0005840 - ribosome [Evidence IDA] [PMID 16702403]; GO_function: GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase activity [Evidence IEA]; GO_function: GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase activity [Evidence IGI,IMP] [PMID 17675291]; GO_function: GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase activity [Evidence IMP] [PMID 17726007]; GO_function: GO:0047184 - 1-acylglycerophosphocholine O-acyltransferase activity [Evidence IEA]; GO_function: GO:0047184 - 1-acylglycerophosphocholine O-acyltransferase activity [Evidence IMP] [PMID 17726007]; GO_function: GO:0047184 - 1-acylglycerophosphocholine O-acyltransferase activity [Evidence IMP] [PMID 17951629]; GO_function: GO:0008374 - O-acyltransferase activity [Evidence IDA,IMP] [PMID 17890783]; GO_function: GO:0016740 - transferase activity [Evidence IEA]; GO_function: GO:0016746 - transferase activity, transferring acyl groups [Evidence IEA]; GO_process: GO:0046474 - glycerophospholipid biosynthetic process [Evidence IGI,IMP] [PMID 17675291]; GO_process: GO:0046474 - glycerophospholipid biosynthetic process [Evidence IMP] [PMID 17726007]; GO_process: GO:0046474 - glycerophospholipid biosynthetic process [Evidence IMP] [PMID 17890783]; GO_process: GO:0006629 - lipid metabolic process [Evidence IEA]; GO_process: GO:0008654 - phospholipid biosynthetic process [Evidence IEA]" /codon_start=1 /product="Ale1p" /protein_id="XP_018737420.1" /db_xref="GeneID:30034485" /translation="
MGHLFINHVEAQIKPDFDVNVIDITGAQMVLCMKLSSFGWNVYDGTLSESSLSELQKDRAVRKHPSLIEFLSYAFFFPSLMTGPSYDYMEFARWMDLSMFDVIHKKASGDTIVKRRIPRSGRVATKKLVQGILWIVLWTQITNYISLEYAQSDKFTVELPFIVRAFYLYALGITYRLKYYGAWTISEGACILSGLGFNGKYTNPKTGKTKYLWNRVQNIDPWAFETGQNTHILLAAWNMNTNKWLKNYVYLRVTPKGRKPGFRSTLATFVTSALWHGTRPGYYLTFVGGAFFQSVGKLFRRNLRPIFVSADGVTPGPYKVYYDITCFVVTQLAFGYIVQPFIILDLKPSLAMWASVYYYVHIAIAISMFLFLGPPKKYITKALKKLQPVPLSHSEQIKIDSLRLKQIKADLDILTSQTSLGIPQPDIDHLDDEIHDAIREMDELRADLIQQLQDFRATHPAHR"
misc_feature 1..1278 /gene="ALE1" /locus_tag="AWJ20_2560" /note="membrane-bound O-acyltransferase family; Region: MBOAT; cl00738" /db_xref="CDD:445070" ORIGIN
atgggccatttgtttattaatcatgttgaggcacagatcaagccggatttcgatgttaatgtcattgatataaccggtgctcagatggtcttgtgtatgaaactcagttcgtttggctggaatgtgtacgatggcacgctgtcagaatctagtctgtcggaattacaaaaagaccgggcagttcgaaaacacccgtcattgattgagtttttgtcatacgcttttttcttcccgtctcttatgacaggcccgtcttatgactatatggagtttgctcgctggatggatctgtccatgttcgatgtcattcataagaaagctagtggtgatactattgtaaagcgacggatccctcgtagtggtcgtgtggccaccaagaaactggtgcagggaatcctgtggatcgtgctatggacccagatcacgaactatatttctcttgagtacgctcaatctgataagttcactgtagaattgccatttattgtgcgtgctttctatctgtacgcactaggtatcacatacagactgaaatattacggtgcttggacaatttccgagggcgcgtgtattctcagtggattaggattcaacgggaaatataccaatcccaagaccggtaagaccaagtatctatggaacagggtgcaaaatatcgacccttgggcctttgaaacgggtcagaatactcatatcctgttggcagcctggaacatgaacactaataaatggctgaaaaactatgtgtatctccgagtgactcctaagggccgtaaacccgggttcagaagtactttagctacatttgtgacttctgctctgtggcatggaacaagaccgggatattatctgacatttgtcggaggtgcatttttccagtctgtaggcaaacttttcagacgaaaccttcgtcccatctttgtatctgctgacggagtcactcctggtccatataaagtgtattacgacattacctgttttgtggtgacacagttggcatttggatacattgtccaacccttcattatcctggacctgaaaccatcattggccatgtgggcatctgtatactactacgtccacatcgcaatagcaatttcaatgttccttttccttggacctccaaagaaatatatcaccaaagcacttaagaaactacagccagtaccattatcacacagcgaacaaatcaagatcgattcactacgactcaaacaaatcaaggccgacctcgacattctcacaagccagacgtcactgggaatcccccaacccgacattgaccacctcgatgacgaaatccatgacgccatccgcgaaatggacgagctccgagccgacctcatccagcaactccaggacttccgggccacccacccggctcaccgctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]