2025-07-15 21:01:05, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_018878509 1269 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Rny1p (RNY1), partial mRNA. ACCESSION XM_018878509 VERSION XM_018878509.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 1269) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 1269) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1269) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031672). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1269 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="A" gene <1..>1269 /gene="RNY1" /locus_tag="AWJ20_1614" /db_xref="GeneID:30033436" CDS 1..1269 /gene="RNY1" /locus_tag="AWJ20_1614" /inference="similar to AA sequence:KEGG_Orthology:K01166" /note="Vacuolar RNase of the T(2) family; relocalizes to the cytosol where it cleaves tRNAs upon oxidative or stationary phase stress; promotes apoptosis under stress conditions and this function is independent of its catalytic activity; GO_component: GO:0005737 - cytoplasm [Evidence IEA,IEA]; GO_component: GO:0005829 - cytosol [Evidence IDA] [PMID 19332891]; GO_component: GO:0005576 - extracellular region [Evidence IDA] [PMID 11158587]; GO_component: GO:0000324 - fungal-type vacuole [Evidence IDA] [PMID 24102742]; GO_component: GO:0005775 - vacuolar lumen [Evidence IEA]; GO_component: GO:0005773 - vacuole [Evidence IEA]; GO_component: GO:0005773 - vacuole [Evidence IDA] [PMID 19332891]; GO_function: GO:0003723 - RNA binding [Evidence IEA]; GO_function: GO:0004519 - endonuclease activity [Evidence IEA]; GO_function: GO:0004521 - endoribonuclease activity [Evidence IDA] [PMID 11158587]; GO_function: GO:0004521 - endoribonuclease activity [Evidence IMP] [PMID 19332891]; GO_function: GO:0016787 - hydrolase activity [Evidence IEA]; GO_function: GO:0004518 - nuclease activity [Evidence IEA]; GO_function: GO:0033897 - ribonuclease T2 activity [Evidence IEA,IEA]; GO_process: GO:0006401 - RNA catabolic process [Evidence IMP] [PMID 19332891]; GO_process: GO:0090502 - RNA phosphodiester bond hydrolysis, endonucleolytic [Evidence IEA,IEA]; GO_process: GO:0006915 - apoptotic process [Evidence IGI] [PMID 19332891]; GO_process: GO:0000902 - cell morphogenesis [Evidence IMP] [PMID 11158587]; GO_process: GO:0090305 - nucleic acid phosphodiester bond hydrolysis [Evidence IEA]" /codon_start=1 /product="Rny1p" /protein_id="XP_018735805.1" /db_xref="GeneID:30033436" /translation="
MLGRPLAFSVGLASLATCVQGIAIDIEGYGRDQLVFAPVTGFESPVRIASDHESCPIDAPLSCSTESVKDSCCYEGTNGLFLSTQFWDYYPPTGPDDVFTLHGLWNDKCNGGYQQYCNPSWGIDNATEVLEELGYTELLTEMNRVWKNLYKTDEDLWLHEFNKHGTCMSTVNPKCYDANAERYQYVGDFFTTAVELFKKLPTYEFLAAADIHPSTTETYTLEQFQNALSPHVGGASVFLQCDQHNSLLEVWYYFKLKGSVAEGTFTPVDAIAKYSKCQDKFYWVPKGTKRGGGGGGGGGGGGGGGGGSGTRGYLKLSGQDGCLIGNGRWYTSGTCATYTIINTVGGINIKSSKGYCNIVDGAFTCNQAVPAGDFTLEEKNVISYGGETTWSASNRPHGTQQTNISPGDDAGDISFELKFVPR"
misc_feature 232..840 /gene="RNY1" /locus_tag="AWJ20_1614" /note="Ribonuclease T2 (RNase T2) is a widespread family of secreted RNases found in every organism examined thus far. This family includes RNase Rh, RNase MC1, RNase LE, and self-incompatibility RNases (S-RNases). Plant T2 RNases are expressed during leaf...; Region: RNase_T2_euk; cd01061" /db_xref="CDD:238512" misc_feature order(241..243,313..315,751..753) /gene="RNY1" /locus_tag="AWJ20_1614" /note="B1 nucleotide binding pocket [chemical binding]; other site" /db_xref="CDD:238512" misc_feature order(253..255,268..270,466..468,745..747) /gene="RNY1" /locus_tag="AWJ20_1614" /note="B2 nucleotide binding pocket [chemical binding]; other site" /db_xref="CDD:238512" misc_feature order(295..318,466..501) /gene="RNY1" /locus_tag="AWJ20_1614" /note="CAS motifs [active]" /db_xref="CDD:238512" misc_feature order(304..306,313..315,319..321,475..480,487..492) /gene="RNY1" /locus_tag="AWJ20_1614" /note="active site" /db_xref="CDD:238512" ORIGIN
atgttgggaaggcccttagcgtttagtgtcggactggctagtctggccacttgtgtccagggcattgcaattgatattgagggctatggacgtgaccagctggtttttgctcccgttactggttttgagagtcctgttagaatcgcgtcagatcacgagtcatgtcccatagatgcccctctctcgtgttctacagagtctgttaaagacagttgttgttatgaggggacaaatggacttttcttgtcaacacaattctgggattattaccctcctactggccctgacgacgtgtttacacttcatggtctttggaatgacaagtgtaatggtggctaccagcagtactgtaacccatcatggggaatcgacaatgccaccgaggtcctagaagagttgggttacactgaattgttgaccgaaatgaatcgtgtgtggaagaatctatacaagacggacgaagacttatggctccatgagttcaacaagcatggaacatgtatgtctactgttaatcccaagtgttatgatgccaatgctgaaagatatcagtacgtgggtgattttttcaccaccgcagttgagctttttaagaagctccctacttacgagtttttggccgcagctgacattcatccttctacaactgagacatacactctagaacagttccagaatgcattatcacctcatgttggtggagcttcggtgttcctgcaatgtgatcaacacaattccttgttagaagtttggtattatttcaagcttaaaggatcagtagctgaaggaacatttactcctgtggatgctatcgccaagtacagcaaatgtcaggacaagttctattgggtaccaaagggtaccaagagagggggtggtggaggaggaggaggcggcggcggcggcggcggaggaggtggtagtggtactagaggatatctcaaactaagtggtcaagatggctgccttattggtaatggtagatggtatacctcgggaacatgtgccacctacaccataataaatactgtcggaggcatcaatatcaagtcatccaaaggatattgtaacatcgtagatggcgctttcacttgtaaccaggcagtgccggctggtgacttcactcttgaagagaaaaacgtgatttcttatggtggcgagacaacctggagcgcatccaacagacctcatggtactcaacagaccaacatctcaccaggcgatgatgcaggtgatatcagcttcgagctcaaatttgttcctcgctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]