GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-05 09:08:35, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_017877086            3439 bp    mRNA    linear   PRI 24-AUG-2016
DEFINITION  PREDICTED: Rhinopithecus bieti nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X2, mRNA.
ACCESSION   XM_017877086
VERSION     XM_017877086.1
DBLINK      BioProject: PRJNA339282
KEYWORDS    RefSeq.
SOURCE      Rhinopithecus bieti (black snub-nosed monkey)
  ORGANISM  Rhinopithecus bieti
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Colobinae; Rhinopithecus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_016806622.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Rhinopithecus bieti Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3439
                     /organism="Rhinopithecus bieti"
                     /mol_type="mRNA"
                     /isolate="Rb0"
                     /db_xref="taxon:61621"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
     gene            1..3439
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 268 ESTs, 4 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:108532817"
     CDS             1..2934
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X2"
                     /protein_id="XP_017732575.1"
                     /db_xref="GeneID:108532817"
                     /translation="
MGLATPGFRMAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDTESKKDSEGCDRSDDRNTVNLFGKVVETTEHNQEPSEATDGNGEVTLTYATRAKEESARVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMAASWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLLPASTRQQIDELRDSDSVCDSGVETSFRKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
     misc_feature    151..756
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(193..195,199..204,208..213,220..231,454..456,
                     460..465,754..756)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    775..1080
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(778..780,784..792,796..804,922..930,967..969,
                     1003..1005,1060..1062,1069..1071,1075..1077)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(784..789,793..795,832..834,838..840,844..846,
                     943..948,955..957,961..963)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(847..849,853..855,946..951)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1519..2301
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1651..1653,1657..1659,1669..1674,1681..1689,
                     1693..1698,1708..1710,1717..1719,1762..1764,1768..1770,
                     1774..1776,1786..1791,1798..1806,1810..1815,1825..1827,
                     1834..1836,1861..1863,1867..1869,1873..1875,1885..1890,
                     1897..1905,1909..1914,1924..1926,1933..1935)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1651..1764
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1768..1863
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1975..2067
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2077..2175
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2470..2697
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
atgggattggcgacaccgggcttcagaatggcagaggatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagatggcccatatcttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtttgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggcttcgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcgtgtataaggggctataatcctggactcttggtgcaccctgaccttgcctatttgcaagcagaaggtggaggggaccggcagttgggagatcgggaaaaagagctaatccgccaagcagctctgcagcaaaccaaggagatggacctcagcgtggtacggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagatgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggggaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggcggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatgttaatattacgaaaccagcctctgtgttcgtacagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctctactatcctgaaatcaaagataaagaagaagtacagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggtgggagtggcgctggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacagggccagggtatagcttcccgcactatggatttcctacttatggtgggattaccttccatcctggaactactaaatctaatgctgggatgaagcatggaaccatggacactgaatctaaaaaggactctgaaggttgtgacagaagtgatgacagaaacactgtaaacctctttgggaaagtcgttgaaaccacagagcacaatcaggagcccagcgaggccactgatgggaatggtgaggtcactctaacgtatgcaacaagagcaaaagaagagagtgctagggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactacgccgtgacaggagacgtgaagatgctgctggccgtccagcgccatctcactgccgtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggctggggccgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaatggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtttgctgctgctggtggccgctggggccgacgtcaatgctcaggagcaaaagtccgggcgcacagcactgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgacgcccatgtggacagtactacctacgatggaaccacacccctgcatatagcagctgggagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtgcctggaaccacgcctctagatatggccgccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactctggcacagaaattaggcctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggagggacagtcagagagctggtggaggctctgagacaaatgggctacactgaagcgattgaagtgatccaggcagcctccagcccagtgaagaccacctctcaggcccactcgctgcctctcttgcctgcctccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccgcaaactcagctttactgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccgtataaaccaaagccctaaaattctactgcattgtccacaaaacagaagctgaagcgcatccagaggtgctcagagagccagcctgcctgaatcattctcgatataactcgagaccttttcaacttggcttcctttcttggttcataaacgaattttagtttggttcacttacagatagtatctagcaatcacagcactggctgagtggatgcatctggggatgaggttgcttactaagctttgccggctgctgccggatcacagctgctttctgttgtcattgcttttgtccctctgctacgttcctattgtcattaaaggtatcactgtctccacctggcattccttctgaccatccacaacatcgttttgcattcaaattaagggttaagaaaagggatattttaaaatgagagtcacttgacgtgccattttaaaaaaaagcatattgctttttctaatgtggttatttctctgatttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]