GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 07:21:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_016205695            3321 bp    mRNA    linear   MAM 11-APR-2016
DEFINITION  PREDICTED: Miniopterus natalensis NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X4,
            mRNA.
ACCESSION   XM_016205695
VERSION     XM_016205695.1
DBLINK      BioProject: PRJNA317472
KEYWORDS    RefSeq.
SOURCE      Miniopterus natalensis
  ORGANISM  Miniopterus natalensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Vespertilionidae; Miniopterinae; Miniopterus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015504386.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Miniopterus natalensis Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3321
                     /organism="Miniopterus natalensis"
                     /mol_type="mRNA"
                     /isolate="MN2012-01"
                     /db_xref="taxon:291302"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="skeletal muscle"
                     /dev_stage="adult"
                     /country="South Africa"
                     /collection_date="Oct-2012"
     gene            1..3321
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:107531582"
     CDS             57..3233
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X4"
                     /protein_id="XP_016061181.1"
                     /db_xref="GeneID:107531582"
                     /translation="
MALFPAFAGVSEAPDSGSARKELDWLSNPSFCVETVTTLSQQTEEATALISEGPPLTSRSPLKSETSDAGDTNRKLRQASRRKKEKKRKRKRQHRSRDRRRRGRSGSSASESGTDPGKDRAPRGFRDADKESEKPNQENNAASAAGRHCVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGASTEKRRSHKHVERYFTRKNVGLMSTDGVAISSHTEPLSSEPVSFIPVKGLDDVAPVTTWLNPLGIYDQSTTLWLQGQGPSEQESKQPDSQPDRENALLKAKVEEFNRRVRENPQDIQLWMAFVAFQDEVMRSPGLYAIEEGEQKRKRSLKLILEKKLAILERAIESNQSSVDLKLAKLKLCTEFWEPSTLLREWQKLIFLHPNNTALWQKYLLFCQSQFSTFSVSKIHSLYGKCLSTLSAVKDGSILSHPELPGTEVAMFALFLQQCHFLRQAGHLEKAVSLFQAMVDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRAGERGARGWRAWMHQQERGGWVVINPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDQRHWRPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSQDLQFQLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEQPLTFLNLSFSGVSCVGRTDQLGCRRWTRGHSREGEEFICNIFHLVMPLFSGRERSQLCSSWLRYEIAKVIWCLHTKNKKRLKSRGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDTALSTAGSGELKDPEVCELSLLYAELELELAPDLRVATEARAVHILTRLAENSPYGPYTGQVLAVHILKARKAYEHALQDCLGESCIPDPASLNRLVSVVKCFMLFQYLTIGIDAAVQIYEHVFPKLKGSVTSEGPSLEDSASPQSARNILEAITLMHTSLLRFHMKVSVYPLAPLRQALSEALKLYPGNQVLWRSYVQIQNKSHSASKSRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRWQRGVRDYS"
     misc_feature    540..827
                     /gene="NRDE2"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(540..566,573..578,588..593,597..599,603..647,
                     654..662,666..674,696..704,714..719,723..728,735..755,
                     780..791,801..827)
                     /gene="NRDE2"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    993..1988
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:429988"
ORIGIN      
acgtccgctcgccggcgccattcccgtagccgggaacggcggtgcggcctgtgactatggcgctgttcccggcctttgcgggcgttagtgaggctcccgatagcgggagcgccaggaaagaattagattggctgagcaacccaagcttttgtgttgaaactgtaacaactctgagccaacaaactgaagaggctacagctcttatttctgaagggccaccactaacaagcaggagccctctgaaatcagagacttcagatgccggggacacaaacagaaagctcaggcaagcgagcaggaggaagaaagagaagaagaggaaaaggaagcgccagcaccgcagcagagacaggaggaggcgagggcggtcagggagcagtgcgtccgagtcaggcactgatcctggaaaggacagagctcccagaggcttcagagatgctgacaaagagtcggagaaaccgaaccaagaaaataatgctgcttctgctgctggacgtcactgtgtttggcttgaggacattcaggctctgactggagaaaccttcagaacagataagaaaccagatcctgcaaactgggagtacaagtccctctaccgaggagatatagcaagatacaagaggaaaggagactcctgcctcggcattaaccctaagaagcagtgtatatcctgggagggggcctccacggaaaagaggcgttcgcacaagcatgtggagcgctatttcacgaggaagaacgtgggactgatgagcacggacggagttgccattagcagtcacactgaacccctctcatctgagccagtctcttttatcccagtgaagggcttggacgatgtggctcctgttacaacctggttgaatcctctgggcatttatgatcaatccaccacactgtggttacagggacagggcccttcagagcaggaatcaaagcagccagactcacagccagaccgagagaacgcccttctcaaggccaaggtggaggagtttaacaggagggtgcgggagaatccccaggatattcagctgtggatggcgtttgttgcttttcaggacgaggtcatgaggagtcctggcctatatgccatcgaggaaggagagcagaagcggaagaggtcgctgaagctcatcctagagaagaagctggccatcctggagcgggccatcgaaagcaaccagagcagtgtggacctgaagctcgccaagctgaagctctgcaccgagttctgggagccctccacgctgctcagagagtggcagaaactgatattcttacatcccaacaatacagccctttggcaaaaataccttttattttgccagagccagttcagcaccttttcagtatcaaaaatccacagtctttatggaaagtgcttgagtactttgtctgcagtgaaggatggcagcatcttatctcaccctgagctgcctggcactgaagtggccatgttcgcgctcttcctgcagcagtgccacttcctgcgccaggctggtcacttggagaaggccgtctccttgttccaggccatggttgacttcaccttcttcaaaccagacagtgtgaaagatctgcccaccaggggacaggtggaattctttgagcccttctgggacagtggagagccccgggctggggagaggggcgcccgaggctggagggcgtggatgcaccagcaggagaggggaggctgggtggtcatcaacccagatgatgatgatgatgaaccggaagatgatgaccaggaaattaaagataagactctgcccaggtggcagatctggctggctgctgagcggtcccgagaccagaggcactggcggccatggcgccctgataagaccaagaagcaaactgaggaagattgtgaggatccagagagacaggtgctgtttgatgatattggacagtctctaatccgactttccagccaagatcttcaattccagctgattgcggcctttctgcagtttttgggtgttccttctggcttcagccctccagcctcctgcctctatctggccatggatgagaacagcatctttgataatggcctttatgacgaacagccattgacttttctcaacctttccttttccggcgtcagctgtgttggtcgcacagaccagttgggctgccggcgctggaccaggggtcacagccgagagggcgaggagttcatctgcaacatcttccacctggtgatgcctttgttttcaggcagggagaggtctcagctctgttcctcctggttgcggtacgagatcgcaaaggtcatttggtgtctgcacactaaaaacaagaagaggctaaagtcacgagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaatttttgcctctggaagcagtatgcacatctggagtggttgctcggcaacacagaggatgccagaaaagtttttgatacagcactcagcacggcagggagcggagagctgaaggaccctgaggtctgtgagctcagtctgctctatgctgagctggagctggagctggcaccggacctcagagtggccaccgaggcccgagctgttcacatattaactaggcttgctgagaacagtccctatgggccctacaccgggcaggtcctggcagttcacattttgaaagctcggaaggcttatgagcatgcactgcaggactgtttgggggagagctgtattcctgatccagcttcccttaaccgcctagttagcgtggttaaatgctttatgctcttccagtatttgaccatagggattgatgctgctgtgcagatatatgagcacgtatttccaaaactgaagggctctgttacctcagaaggcccaagcctggaagacagtgccagcccacagagtgcaaggaacattctcgaggctatcacactgatgcacacgagtctgctcaggttccacatgaaagtcagtgtttaccctctggctccgctgcgacaggcgctttcagaggctttgaagttgtatccgggcaaccaggttctttggaggtcctatgtacagattcaaaacaagtcccacagcgccagcaagagcaggagattctttgatgcaattaccaggtctgcgaaacccttggagccatggttgtttgccattgaagctgagaaaatgaggaaaagactggtggaaactgtccagagatggcagagaggtgtacgcgactattcctgagactggcttgacgcaccggatcagagccctgtttgaaaatgcgatccgcagtgaccacggcagccagtgtcctttactgtggaggctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]