2025-04-04 14:30:11, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_014688570 1119 bp mRNA linear PLN 26-JUN-2024 DEFINITION Metarhizium brunneum Protein disulfide-isomerase erp38 (erp38), partial mRNA. ACCESSION XM_014688570 VERSION XM_014688570.1 DBLINK BioProject: PRJNA1128270 BioSample: SAMN15394350 KEYWORDS RefSeq. SOURCE Metarhizium brunneum ORGANISM Metarhizium brunneum Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Clavicipitaceae; Metarhizium. REFERENCE 1 (bases 1 to 1119) AUTHORS Saud,z., Kortsinoglou,A., Kouvelis,V.N. and Butt,T.M. TITLE Telomere length de novo assembly of all 7 chromosomes of the fungus, Metarhizium brunneum, using a novel assembly pipeline JOURNAL Unpublished REFERENCE 2 (bases 1 to 1119) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (26-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1119) AUTHORS Saud,z., Kortsinoglou,A., Kouvelis,V.N. and Butt,T.M. TITLE Direct Submission JOURNAL Submitted (09-JUL-2020) Biocontrol and Natural Products Group (BANP), Biological Sciences, Swansea University, Singleton Park Campus, Swansea SA28PP, United Kingdom COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_089428). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1119 /organism="Metarhizium brunneum" /mol_type="mRNA" /strain="4556" /host="Boophilus sp. [Acari: Ixodidae]" /db_xref="taxon:500148" /chromosome="7" /geo_loc_name="USA: Florida" /collection_date="29-Sep-1993" gene <1..>1119 /gene="erp38" /locus_tag="G6M90_00g107880" /old_locus_tag="MBR_06173" /db_xref="GeneID:26243443" CDS 1..1119 /gene="erp38" /locus_tag="G6M90_00g107880" /old_locus_tag="MBR_06173" /codon_start=1 /product="Protein disulfide-isomerase erp38" /protein_id="XP_014544056.1" /db_xref="GeneID:26243443" /db_xref="GO:0005783" /db_xref="GO:0016853,GO" /db_xref="GO:0045454,GO" /db_xref="InterPro:IPR005788" /db_xref="InterPro:IPR011679" /db_xref="InterPro:IPR013766" /db_xref="PFAM:PF00085" /db_xref="PFAM:PF07749" /db_xref="TIGRFAM:TIGR01126" /translation="
MVLIKSLVLAAVAAVATARSAVMDLTPANFDKVVLKSGKPTLVEFFAPWCGHCKSLAPVYEELAVAFEHAKDKVQIAKVDADAERELGKRFGIQGFPTLKYFDGKSDKPEEYKSGRDLESLTEFLTEKAGVKAKKKLEMPSEVVMLTDKSFAETVGSEKNVLVAFTAPWCGHCKNLAPTWESLAADFVGEANVVIGKVDAEAPNSKAVATEQGVTSYPTIKWFQAGSKTGESYDGARSEDDFIKFINEKAGTHRVVGGGVDRVAGTIAVLDALVAKFTGGAKLEDIVGEVKSAVEKFNDDAKYAYAKYYVRVFDKLSKSDNYVSKELSRLEGILEKGGLAPSKRDEIQSKTNVLRRFAEKAAEKAEELKDEL"
misc_feature 67..375 /gene="erp38" /locus_tag="G6M90_00g107880" /old_locus_tag="MBR_06173" /note="PDIa family, endoplasmic reticulum protein 38 (ERp38) subfamily; composed of proteins similar to the P5-like protein first isolated from alfalfa, which contains two redox active TRX (a) domains at the N-terminus, like human P5, and a C-terminal domain...; Region: PDI_a_ERp38; cd02998" /db_xref="CDD:239296" misc_feature order(148..150,157..159,346..348) /gene="erp38" /locus_tag="G6M90_00g107880" /note="catalytic residues [active]" /db_xref="CDD:239296" misc_feature 427..738 /gene="erp38" /locus_tag="G6M90_00g107880" /old_locus_tag="MBR_06173" /note="PDIa family, endoplasmic reticulum protein 38 (ERp38) subfamily; composed of proteins similar to the P5-like protein first isolated from alfalfa, which contains two redox active TRX (a) domains at the N-terminus, like human P5, and a C-terminal domain...; Region: PDI_a_ERp38; cd02998" /db_xref="CDD:239296" misc_feature order(508..510,517..519,709..711) /gene="erp38" /locus_tag="G6M90_00g107880" /note="catalytic residues [active]" /db_xref="CDD:239296" misc_feature 793..1071 /gene="erp38" /locus_tag="G6M90_00g107880" /old_locus_tag="MBR_06173" /note="Endoplasmic reticulum protein ERp29, C-terminal domain; Region: ERp29; pfam07749" /db_xref="CDD:462253" ORIGIN
atggtcctcatcaagagcctcgtgctcgccgccgtggccgccgttgcgaccgccagatccgccgtcatggatcttactcctgcaaacttcgacaaggtagtcctcaagtcgggaaagcctacacttgttgaattctttgccccctggtgcggccactgcaaaagcctggctcccgtgtacgaggagctcgccgtcgcctttgaacacgccaaggacaaggtacagattgccaaggtcgatgccgatgccgagcgggagttgggcaagcgttttggaatccagggattccctacgctcaagtactttgacggaaagtcagataagcccgaggagtacaagtctggccgagacctggagagcctgaccgagttcctgacggagaaggctggggtcaaggctaagaagaagctggagatgcctagcgaggttgtgatgcttactgataagagctttgcggagactgtcggaagtgaaaagaatgtgctggttgcgtttaccgctccttggtgcgggcactgcaagaacctggcacccacgtgggagagccttgctgccgatttcgtcggtgaggccaatgttgtcattggcaaggttgatgccgaagctcccaacagcaaagccgtggccaccgaacagggtgtcacttcttacccgaccatcaagtggttccaagctggaagcaagacgggcgagagctacgatggtgcccgctctgaggacgacttcatcaagttcatcaacgagaaggctggaacgcaccgcgttgtcggcggtggtgttgaccgtgttgctggaaccattgccgtccttgacgcgctggttgccaagttcaccggcggcgccaagttggaggatattgtcggcgaggttaagagtgccgtggagaagttcaacgacgatgccaagtatgcctacgccaagtactatgtccgtgtctttgacaagctgagcaagagcgataattatgtctccaaggagctctcaagactcgagggcatcttggagaagggtggcctggccccgtctaaacgtgacgagattcagagcaagaccaatgttctgcgccgcttcgctgagaaggctgctgagaaggccgaggagctcaaggacgagctgtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]