GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-01 05:59:46, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_013558139            4468 bp    mRNA    linear   INV 28-FEB-2018
DEFINITION  PREDICTED: Lingula anatina copper-transporting ATPase 1-like
            (LOC106175926), transcript variant X5, mRNA.
ACCESSION   XM_013558139
VERSION     XM_013558139.2
DBLINK      BioProject: PRJNA293030
KEYWORDS    RefSeq.
SOURCE      Lingula anatina
  ORGANISM  Lingula anatina
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Brachiopoda;
            Linguliformea; Lingulata; Lingulida; Linguloidea; Lingulidae;
            Lingula.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019775502.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Feb 28, 2018 this sequence version replaced XM_013558139.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Lingula anatina Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4468
                     /organism="Lingula anatina"
                     /mol_type="mRNA"
                     /isolate="Amm_Jpn"
                     /isolation_source="intertidal zone"
                     /db_xref="taxon:7574"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="Gonads"
                     /dev_stage="adult"
                     /geo_loc_name="Japan: Amami, Kasari Bay"
                     /lat_lon="28.4406 N 129.6676 E"
                     /collection_date="2012"
                     /collected_by="Nori Satoh, Kazuyoshi Endo"
                     /identified_by="Kazuyoshi Endo"
     gene            1..4468
                     /gene="LOC106175926"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:106175926"
     CDS             4..4374
                     /gene="LOC106175926"
                     /codon_start=1
                     /product="copper-transporting ATPase 1-like isoform X5"
                     /protein_id="XP_013413593.1"
                     /db_xref="GeneID:106175926"
                     /translation="
MMSEAVISIQGMTCQSCVKNIEVNMAAFPGISTIEVSLENQEGVVSFDPTVTTAEKIAEGIDDMGFEAKVKSPGSSPQEVTIYIEGMTCQSCVKNIEGAISMRSGVKQIKVSLSQKQASIRYDPSQTNPRTLREHIDDMGFEAFLEKPKQTVNVKIGVEGMTCQSCVKNIEGNMSSKPGVRHIQVSLERKEANITYDPSVVTAQMLRDQINDMGFEATLPSNGSSTSFDEFHELAKTRSHADFGKCRLHIEGMTCQSCIKNIEGVIGEFPGVKTIKVTLETKSADVTFDSSIVTAQAVADRISDMGFDCNVADQQDEFDEIASRSAPTKSPPDGTLAKCMVDIEGMTCMSCVKNIEGTLSDEKGIAQVSVSLEEKRGTVQYDPALWSPTTVAERISDMGYDSVVHAAAIPKVPSTISTTVISIKGMTCNSCVKTIQEVISEKPGVRSIKVSLQEEQGVIQYDPDVTSPQQLRDAIDDMGFDACITDETKFPPETTVIMNGSAGPVKSTPSRGHLPKTNHGMVLQRKVDTVEEDDLEKCHLHVSGMTCASCVANIERNLLKVPGISSVLVALMAQKAEVKYDPAYMMPSQIATLVTELGYPAMLIENEGTGDGHLEIQIGGMTCSSCVHRIESHMVKQPGIKSAIVSLATNRGRFEFDPENTGPRDIMNEIRDMGYEASLVTDNSKNSAAHEHRKTTRQWRNSFLFSLILGVPCMVVMMYFMFAYMHMPGHQMAAGGSNDTADSSPGVPMVTAGLSVENLILFLLATPVQFIGGRYFYIQAYKALKHRSTNMDVLIVMATTISYVYSVIVVAVAMVMQESTSPRTFFETTPMLMVFISLGRWLEHIAKGKTSEALTKLMSLQASEALLLECDKNGQVIKEQRISVDLVHRGDILKVLPGEKIPVDGKVTEGHSMCDESLITGESMPVEKKKGSSVIGGSINQNGTLLVEATHVGADSALAQIVRLVEEAQTSKAPLQAVADTIAGYFVPGVCTISLLTAVVWVIVGYATYNQLDIHWKSESGMGKNEIIFQHAFKFAITVLAIACPCALGLATPTAVMVGTGVGATNGILIKGGEPLEIAHKVQSIVFDKTGTITRGIAELTRLTLFNTGLSKHLVIAVTGTAETSSEHPVAAAIVKYAKQALGAETLGKVLDFQAVPGCGLKCRVTNVDHLVSSMETKDILKEHTNIDRDEIQDLQDAPSSSGYEVLIGNREWMSRNMLTVTEAMDQEMSYHENKGETAVLCAINGEIVAMLAVADTVKEEAHLAVYTLKKMGLNVFLLTGDNLKTAKAIAKQVGISKVFAEVLPSHKVAKIKQLQKDGHRVAMVGDGVNDSPALAQADLGIAIGTGTDVAVEAAGVVLIRNDLLDVVAAMRLSKKTVRRIRFNFLAATIYNIVGIPVAAGALFPIGIELMPWMASAAMAASSVSVVCSSLLLKLFKMPRPEDLLTSEYKARLQET"
     misc_feature    19..210
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(37..45,52..54)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    244..432
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(262..270,277..279)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    475..657
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(484..492,499..501)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    742..927
                     /gene="LOC106175926"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1021..1206
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1039..1047,1054..1056)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1261..1449
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1279..1287,1294..1296)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1627..1806
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1636..1644,1651..1653)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1846..2037
                     /gene="LOC106175926"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1864..1872,1879..1881)
                     /gene="LOC106175926"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2104..4242
                     /gene="LOC106175926"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3133..3135,3139..3141,4174..4176)
                     /gene="LOC106175926"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3265..3273,3469..3471,3625..3633,3721..3723,
                     3841..3849,3907..3909,3916..3918,3925..3927,3982..3984,
                     3991..3993)
                     /gene="LOC106175926"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
aagatgatgagtgaagcagtgatcagtatccaaggcatgacttgccagtcttgtgtgaaaaatatagaagtgaacatggcagcattccctggaatatccacaattgaggtttctctagaaaaccaggaaggtgttgtaagctttgatcccaccgttaccactgcagagaagattgctgagggaatagatgacatgggttttgaagccaaagttaagtcccctgggtcctccccccaggaagtgacaatctacatagagggaatgacctgtcagtcttgtgtcaaaaacatagagggtgccatcagcatgaggtcaggggtcaagcagatcaaggtatcattatcgcagaaacaggcgagcataaggtatgacccctctcagaccaatcctagaactctacgtgaacacatcgacgatatgggttttgaggcttttctggaaaaaccgaagcagacggtgaatgtgaaaattggagtagagggtatgacctgccagtcttgtgtcaagaatattgaagggaatatgtccagcaaaccgggagtgaggcacattcaagtttccctggagagaaaagaggccaatatcacgtatgacccctccgttgttacagcacagatgttacgagatcaaatcaatgacatggggtttgaggcaacacttcccagcaatggatcctcaacatcttttgatgaatttcatgaactcgctaagacaagaagccatgctgactttggcaaatgtaggttacacattgaggggatgacttgtcagtcgtgcattaagaacattgaaggggttatcggtgaattcccaggagtgaaaactatcaaggtgactttggagaccaaatctgctgatgttacttttgactccagcattgttactgcccaggcagtggcggatagaatatctgatatgggtttcgactgcaatgtggctgaccaacaggatgagtttgatgaaatagccagtagaagtgctcccacaaaatctcccccagatggcactctagccaagtgtatggttgatattgaagggatgacctgtatgtcttgtgttaagaacatcgagggtactctttctgatgagaaggggatcgcacaagtcagtgtttctctggaagagaaaaggggtacagtgcagtatgatcccgccctctggtcccccaccactgtggccgagagaatcagtgacatgggctatgattctgtagtccatgctgcagccattcctaaggtgccctccactatcagcacaactgtcatctccatcaaaggaatgacatgcaattcctgtgtgaagacaatccaggaagtgatttctgagaaaccaggggtgagatctataaaagtgtctctgcaggaagagcagggagttatccaatatgatcctgacgtcacgtcaccccagcagctgcgagacgccatagatgatatgggctttgatgcatgcatcacagatgagaccaaattcccaccagaaaccaccgtgataatgaacggcagtgcagggccagtgaagtccacgccttcacgcggccatctacccaagaccaaccatggcatggtcctacaaaggaaggtggacacagtggaagaggatgacctggagaaatgccacctccatgtgtctggaatgacctgtgcttcttgtgtggctaatattgagaggaacttactgaaagtgcctggtatttcttcagtgttggtggctttgatggcccagaaagcagaagtgaagtatgatcctgcctacatgatgccctcccagattgctaccctggtcacagaactgggctaccccgccatgctgatcgagaatgaaggaacaggtgatgggcaccttgaaatccagattggtggtatgacatgttcatcctgtgtccaccgtatagagtcccatatggtgaaacaaccaggcatcaagtctgccatagtttccctggctaccaataggggacgctttgagtttgatccagaaaacacaggaccaagagatattatgaatgaaataagggatatgggatatgaggcttccctggtcacagacaattccaagaattctgctgcacatgaacacaggaaaactaccaggcagtggagaaattcattcctgttttccctcatacttggtgtaccttgtatggtggtcatgatgtacttcatgtttgcttatatgcacatgcctggtcaccagatggcagcaggtggcagtaatgatacagctgattcctcgccaggtgtccccatggtgacagcaggactgtctgtggagaacttgattctatttttactggcaactcctgtacagtttattggtgggagatatttttatatccaagcctacaaagctttgaaacacagatccaccaatatggatgtccttattgtcatggcaaccacaatatcatatgtttactcagttattgttgtggctgttgccatggtgatgcaagagtccacaagcccacgtacattctttgagaccacacctatgttaatggtgtttatatcattgggacggtggcttgaacatatagcaaagggcaagacatcagaggccctgaccaagctgatgtctctgcaggccagtgaggctctactgctggagtgtgacaagaatggccaggtgatcaaggaacagaggatcagtgtggacttagttcacaggggagatattctcaaggtcctgcctggagagaagattccagtggatggtaaagtgacggagggacactccatgtgtgatgaatctcttatcactggagagtccatgcccgtggagaagaaaaaaggttcttctgtgattggaggatctatcaaccagaatggcactctgttggtggaagctacacatgtgggggcagacagtgctcttgctcaaatagtcaggcttgtggaagaagctcaaacatccaaagctcctctgcaggcagtggcagacaccatagctggctattttgtccctggggtttgcaccatctctctcctcacagctgtagtatgggttatagtgggctatgccacttataaccagttggacattcattggaaatcagaaagtggaatgggcaagaacgaaatcatcttccagcatgcgtttaagtttgccatcacagttctagcaatagcctgtccctgtgccctgggcctggccacacccactgctgttatggtggggacaggggtgggggctactaacgggatactcatcaagggaggagagccattagagattgcacacaaggtacagagtattgtgtttgacaagacaggcacaataacgcgtggtatagcagagttgactagactgacactgtttaatacagggttgtccaaacatctggtgattgctgtcactgggactgcagaaaccagcagtgaacaccctgtagctgcagccattgtcaaatatgccaaacaggcattgggtgcagagaccctgggcaaggtgttggatttccaagctgtcccaggctgtggcttgaagtgtagagtgaccaatgttgatcatctggtgagcagtatggaaacaaaggacattctcaaagaacacactaatattgacagagacgaaatacaagacctgcaagatgccccatcctccagtggctatgaggtattgataggtaacagggagtggatgagccgtaacatgctgacagtcactgaggccatggaccaggaaatgtcatatcatgaaaacaagggagaaactgcagtactctgtgcaattaatggtgagatagttgccatgctggccgtggcagacacagtgaaggaagaggctcaccttgctgtgtacacactgaagaaaatgggactcaatgttttcctcctcacaggagacaatctcaagacagctaaggcaatagccaaacaggttggcatcagtaaagtgtttgcggaagtgttaccatctcacaaagtggccaagatcaagcaactccagaaggacgggcaccgtgtggccatggtaggggatggggtcaatgattccccagccctggcacaggctgacctaggcattgccataggaacaggaactgatgttgccgtggaagcagcaggcgtggtgctaattaggaatgacctgttagatgtggtggcggccatgcgtctgtcaaagaagacagtgaggaggataaggttcaacttcctggctgctaccatctacaacatagtgggaatacctgtagctgctggtgctttattcccaattggtattgaattaatgccatggatggcctctgcagcaatggctgcctcatccgtgtctgtcgtctgctcttcattgttgctgaaacttttcaagatgccacgtcctgaagatcttctgacaagtgaatataaggccaggcttcaagaaacctaacagagaggacctcctgacacaagagtactttcagaagttcagctcaggcagggacgagtatggggaggatgatatttctgtccactgcggtatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]