GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-12-08 15:24:28, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_013039291            1203 bp    mRNA    linear   PLN 29-JUN-2015
DEFINITION  Blastocystis hominis mRNA.
ACCESSION   XM_013039291
VERSION     XM_013039291.1
DBLINK      BioProject: PRJNA263384
KEYWORDS    RefSeq.
SOURCE      Blastocystis hominis
  ORGANISM  Blastocystis hominis
            Eukaryota; Sar; Stramenopiles; Bigyra; Opalozoa; Opalinata;
            Blastocystidae; Blastocystis.
REFERENCE   1
  AUTHORS   Wincker,P.
  TITLE     Sequencing and annotation of the Blastocystis hominis genome
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1203)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (26-JUN-2015) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1203)
  AUTHORS   Wincker,P.
  TITLE     Direct Submission
  JOURNAL   Submitted (12-FEB-2010) Wincker P., Genoscope - CEA, Sequencing, 2
            rue Gaston Cremieux, F-91057, FRANCE
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_013171816).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1203
                     /organism="Blastocystis hominis"
                     /mol_type="mRNA"
                     /isolate="Singapore isolate B (sub-type 7)"
                     /db_xref="taxon:12968"
                     /note="scaffold_1"
     gene            <1..>1203
                     /locus_tag="GSBLH_T00006172001"
                     /db_xref="GeneID:24922297"
     CDS             1..1203
                     /locus_tag="GSBLH_T00006172001"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_012894745.1"
                     /db_xref="GeneID:24922297"
                     /db_xref="GOA:D8LYP2"
                     /db_xref="InterPro:IPR000212"
                     /db_xref="UniProtKB/TrEMBL:D8LYP2"
                     /translation="
MSDFISILDLKVNAAKSKSKSNVIQIPNSWNRENSLKKPEVFQWKDIEKNGYGVRLNEFYSAVEEQEEIVNQIKKILKGPAMAKTRSENSVEELVKENRFENHPMNHVIGVFFKTQKEVEQFCTLLKQEGLPYRGNEETSNFSEGINILRLLYDPNDSRSYDMMTVLQLPSLEISTTTLQTFIQNCKRNHQSLYETVKEALKTEANLPQNEWRNLSKLMSTIQSLHNQLLNYPGSYLLYQFYNRIHELPQIMNDSERQSSLIGLLNELMYLEDGHSPLLKSNSSSPFFKLHDYIDFLSFIPLFPSTSILDRLRSLQGHPLTKLLLTQCDSNPEEKDETSPIDSNVILVGTYADRYPNYFTVAHFVYSFISVSLFASVECFQDFTSSRQFFLFVPGMRHCP"
     misc_feature    <151..>777
                     /locus_tag="GSBLH_T00006172001"
                     /note="Superfamily I DNA or RNA helicase [Replication,
                     recombination and repair]; Region: UvrD; COG0210"
                     /db_xref="CDD:439980"
ORIGIN      
atgagcgatttcatttcgattttggacttgaaagtgaatgctgcgaaatcaaaatcaaaatcgaatgtgattcagatcccgaactcatggaatcgagagaattctctcaagaaaccggaagtgtttcagtggaaagatatcgaaaagaacggctatggagtgcgattgaatgagttctattctgcagtggaggaacaagaagagattgtgaatcagatcaaaaagatcttgaagggtcctgcgatggcaaaaacaagatccgagaattcagtcgaggaattggtgaaagaaaatcggtttgaaaaccatccaatgaatcacgtcattggagtattcttcaagacacagaaagaagtcgagcagttctgcacgcttctgaaacaagaagggcttccctatcgtggaaacgaggaaactagcaacttttcggagggaatcaacattctccgtcttctttatgatccaaacgactctagaagttatgatatgatgacagtgttacaacttccttcgcttgaaatctccacaacgaccctccaaacttttattcagaactgtaaacgaaatcatcaaagtctttatgaaacggtgaaggaggcgttgaaaactgaagcgaatcttccacagaatgaatggagaaacttgtcgaaattaatgtcgacgatccaatcattgcataatcaattactgaattatcctgggtcttatcttctttaccagttttataatcgaattcatgaattaccacaaatcatgaacgattctgaacgccagtcttcattgattggtctgttgaatgaattgatgtatttggaagacggccattcgcctcttttgaaatcgaactcgtcttctccattctttaaacttcacgactacattgatttcctttcattcattcctctctttccttccacttccatcttggatcgattgcgaagccttcaaggccatcctttaacgaaacttcttcttacgcaatgtgactccaatccagaagaaaaggatgaaaccagcccaatcgattccaacgttattcttgtcggaacatacgcagatcgatatcccaattacttcacagtagctcattttgtgtattcattcatttcagtctctctttttgcctcagttgaatgcttccaggatttcacttcatcgcgtcagttcttcctgtttgttcccggaatgcgccattgtccctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]