GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-12-08 15:24:19, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_012636181             666 bp    mRNA    linear   PLN 09-DEC-2022
DEFINITION  PREDICTED: Gossypium raimondii hypothetical protein (LOC105803782),
            mRNA.
ACCESSION   XM_012636181
VERSION     XM_012636181.2
DBLINK      BioProject: PRJNA907401
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Gossypium raimondii (Peruvian cotton)
  ORGANISM  Gossypium raimondii
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Malvales; Malvaceae; Malvoideae;
            Gossypium.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_068575) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 9, 2022 this sequence version replaced XM_012636181.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Gossypium raimondii Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..666
                     /organism="Gossypium raimondii"
                     /mol_type="mRNA"
                     /isolate="GPD5lz"
                     /db_xref="taxon:29730"
                     /chromosome="11"
                     /tissue_type="leaf"
                     /genotype="D5"
     gene            1..666
                     /gene="LOC105803782"
                     /note="hypothetical protein; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     Protein"
                     /db_xref="GeneID:105803782"
     CDS             1..666
                     /gene="LOC105803782"
                     /codon_start=1
                     /product="uncharacterized protein LOC105803782"
                     /protein_id="XP_012491635.2"
                     /db_xref="GeneID:105803782"
                     /translation="
MRKYNRLRSIAKVFRIFEVLSALLFLAWTAERVPFAVKISGEFVLKLGGIIASPFFVFLICNVIIITLIAKSGIFSAVRNADSKVCEEIIKTADTHSKSVSQEEIVYQDKEIISEVNTSTRECEDMEPEPEPESDSDFEADNPRVYRRSKSEKLEREKVKKELRRSESEKKCRKIENMDEKLFPEDDLSNEEFQRAIEDFIAKQLRFRREESLSIVLHSQA"
ORIGIN      
atgaggaaatacaatcgtcttcgaagcatagcaaaggtgtttcgtatttttgaagtgctttcggctttgctgtttttggcgtggactgccgagcgcgtgccttttgccgtcaaaatctccggcgagtttgtattgaaactcggcggcatcatcgccagtccgttctttgttttcctcatctgtaacgtcatcatcatcactctaattgctaagtccggtatcttctccgccgttcgcaatgccgattccaaagtctgcgaggaaatcatcaagaccgcagacactcactccaaatcggtgtctcaagaagagattgtgtatcaagataaggagatcatctctgaagtgaacacatctactcgcgagtgcgaagacatggaaccagaaccggagccagagtcagactctgactttgaagccgataatccgagagtgtataggagaagtaaatcggagaagttggaaagggagaaagtgaaaaaggaactacgacgatcggagagcgagaagaagtgccgaaaaattgaaaacatggacgaaaaattatttcctgaagacgatttgagcaatgaagagtttcaacgagcgatcgaagactttattgctaaacagttgaggtttcgccgagaagagtctctgtctattgttcttcatagccaagcttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]