GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-29 22:47:49, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_009082080            2428 bp    mRNA    linear   VRT 05-SEP-2014
DEFINITION  PREDICTED: Acanthisitta chloris argonaute RISC catalytic component
            4 (AGO4), partial mRNA.
ACCESSION   XM_009082080
VERSION     XM_009082080.1
DBLINK      BioProject: PRJNA253841
KEYWORDS    RefSeq.
SOURCE      Acanthisitta chloris (rifleman)
  ORGANISM  Acanthisitta chloris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Passeriformes; Acanthisittidae; Acanthisitta.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008691020.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Acanthisitta chloris Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2428
                     /organism="Acanthisitta chloris"
                     /mol_type="mRNA"
                     /isolate="BGI_N310"
                     /db_xref="taxon:57068"
                     /chromosome="Unknown"
                     /sex="female"
                     /geo_loc_name="New Zealand"
     gene            1..>2428
                     /gene="AGO4"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 10 ESTs, 24 Proteins"
                     /db_xref="GeneID:103809253"
     CDS             182..>2428
                     /gene="AGO4"
                     /codon_start=1
                     /product="protein argonaute-4"
                     /protein_id="XP_009080328.1"
                     /db_xref="GeneID:103809253"
                     /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSIQWVSVVSLQMLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNISEQSKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRAR"
     misc_feature    191..445
                     /gene="AGO4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    476..628
                     /gene="AGO4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    629..991
                     /gene="AGO4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(785..787,830..832,872..874,884..886,938..940,
                     959..961,965..967)
                     /gene="AGO4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1130..2428
                     /gene="AGO4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1541..1543,1553..1555,1589..1600,1607..1609,
                     1631..1633,1640..1642,1652..1654,1664..1666)
                     /gene="AGO4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1745..1747,1751..1753,1991..1993,2405..2407)
                     /gene="AGO4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcccccagcgagtctcttccagccgccgcgccgccccggcctgggcaccgtggggaaacccattcgcctcctggccaaccacttccaggtgcagatcccgaagattgatgtgtatcactatgatgtggatatcaaaccagagaaacggccccgaagagtcaacagggaggtggtggataccatggtgaggcacttcaagatgcagatatttggggatcggcagcccgggtatgatgggaagaggaacatgtacacggcacacccgttacccatcggcagggacagggtggatatggaggtgacacttccaggagaggggaaggaccagacgttcaaggtttccattcagtgggtgtcggtcgtcagccttcagatgctgctggaagctctggcaggacacttgaatgaagttcctgaagattctgtacaggcactggatgtgatcacacggcaccttccctccatgaggtacacccctgtgggtcgctccttcttctccccccctgaaggctactaccaccccctgggagggggcagggaggtctggttcgggttccaccagtcggtccgacctgccatgtggaacatgatgctcaacatcgacgtgtcagcaactgctttctatcgtgcccagcctatcattgagttcatgtgtgaggtcttggacatccagaacatcagtgagcagagcaaacctctgacagactcccagcgcgtcaagtttaccaaagaaatcagaggtctcaaggtggaggttacccactgtggccagatgaagaggaaataccgagtttgcaacgttacacggcgaccggcgagtcaccagacgttccctctgcagctggagaatgggcaggccatggagtgcacggtggctcagtacttcaagcagaagtacagcctgcagctgaaataccctcacctgccctgcctgcaggtggggcaggagcagaagcacacgtacctgcccctggaggtgtgtaacatcgtggcaggccagagatgcatcaagaagctcacggacaatcagacttcgaccatgatcaaagcgacagccaggtctgccccggacaggcaggaggagatcagcagactggtgaagagcaacagcatggtgggtggccctgacccgtacctgaaggagtttggcattgttgtccataacgaaatgacagagctgacaggcagagtgctgccagccccaatgctgcagtatggaggcaggaacaagactgtggccacaccaaaccaaggcgtgtgggacatgagggggaaacagttctacgccggcattgagattaaagtctgggctgtggcctgttttgctcctcagaaacaatgcagggaagacttgctgaagagtttcaccgaccaactgcgcaagatctccaaggacgctgggatgcccatccagggccagccctgcttctgcaagtatgcccaaggggcagacagcgtggagcccatgttcaagcacctgaagctgacctacgtggggctgcagctcatcgtggtgatcctgcctgggaagacacccgtgtacgctgaagtcaagcgggttggagacactcttctaggcatggccacacagtgtgtgcaggtaaagaatgtggtcaaaacctcaccacagacactgtccaacctgtgtctgaagatcaacgcgaagcttggagggatcaacaacgtgctggtacctcatcaaaggccctcggtgttccagcagccagtgatcttcctgggggcagacgtgacccaccctccagccggggacgggaagaagccgtcgatcgcggccgtggtgggcagcatggacgggcaccccagccgctactgcgccacggtgcgcgtgcagacctcgcgccaggagacctcccaggagctgctctacagccaggaggtcatccaggacctcaccaacatggtgagggagctcctgatccagttctacaaatccacacgcttcaagcccaccaggatcatctactacagagggggagtgtcggaaggacagatgaaacaggtggcctggcccgagctgatcgccatcaggaaggcctgcatcagtttggaggaggactacagaccaggaataacctacatcgtggtgcagaagaggcaccacaccaggctcttctgtgctgacaaaaccgagagggtgggtaagagcggcaacgtaccagcagggactactgtggacagcaccatcacacatccctcggaatttgacttttacctctgtagccatgcaggaattcagggaaccagccgtccctcccactaccaggtgttgtgggatgacaactgcttcacggcggacgagctgcagctgctgacctaccagctgtgccacacctacgtgcgctgcacgcgctccgtctccatccccgcgcccgcctactacgctcacctggtggccttcagggccagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]