GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 20:32:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_008431052            1259 bp    mRNA    linear   VRT 21-JUN-2016
DEFINITION  PREDICTED: Poecilia reticulata C-type lectin domain family 4 member
            G-like (LOC103477754), mRNA.
ACCESSION   XM_008431052
VERSION     XM_008431052.2
DBLINK      BioProject: PRJNA232869
KEYWORDS    RefSeq.
SOURCE      Poecilia reticulata (guppy)
  ORGANISM  Poecilia reticulata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
            Poeciliidae; Poeciliinae; Poecilia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_024346.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 21, 2016 this sequence version replaced XM_008431052.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Poecilia reticulata Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1259
                     /organism="Poecilia reticulata"
                     /mol_type="mRNA"
                     /strain="Guanapo"
                     /isolation_source="inbred female from a population that
                     was originally collected from the Guanapo drainage in
                     Trinidad in 2010"
                     /db_xref="taxon:8081"
                     /sex="female"
                     /linkage_group="LG16"
     gene            1..1259
                     /gene="LOC103477754"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:103477754"
     CDS             25..1167
                     /gene="LOC103477754"
                     /codon_start=1
                     /product="C-type lectin domain family 4 member G-like"
                     /protein_id="XP_008429274.1"
                     /db_xref="GeneID:103477754"
                     /translation="
MKTANQQESIKTLITDRRQLIEEQKMMENEMEEVVRDRHLSLEKAGFIQKRLTQVREELNKERDELRNKIDELSREKDELSRKNDELSNEKDEPNDEKDELNKERDELSRKTEELSKERDELRNKINELSREKDELSRKNDELNNEKDELSRKTEELSKERDRLSEDKHELRQEKDKLNKEKKDLSTEKEELKKEREKLRVLTDQAEKRCRERDALKNFYDALMKFDNFPVRDLCPVSLRPKCQHCAKHEKSYKGHCYYIYPYDIGYANWDRSRQLCKTEGGDLVVIDDLEEQEFINNHTQKYDSDNHGYWIGLHHFRHNWSWVDGRRNFLEFWIEGIPRSSGAALHMPRQKATESWRAEDKMEASKFICERLEISWPFG"
     misc_feature    <37..696
                     /gene="LOC103477754"
                     /note="Chromosome segregation ATPase [Cell cycle control,
                     cell division, chromosome partitioning]; Region: Smc;
                     COG1196"
                     /db_xref="CDD:224117"
     misc_feature    760..1137
                     /gene="LOC103477754"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(1057..1059,1063..1065,1072..1074,1090..1092,
                     1096..1107,1114..1122)
                     /gene="LOC103477754"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
ORIGIN      
ctaatttgtgtttttatagtgaatatgaagacagccaatcagcaggaaagtatcaaaacccttataacagatagaagacaacttattgaggaacaaaagatgatggagaacgagatggaggaggtggtccgagacagacacctgagcctagaaaaagctgggtttatccaaaagaggctaactcaagtcagagaggagctgaacaaagagagagacgagctgaggaataagattgacgagctgagcagagagaaagatgagctgagcagaaagaacgacgagctgagcaatgagaaagacgagccgaacgatgagaaagacgagctgaacaaagagagagacgagctgagcaggaagacagaggagctgagcaaagagagagacgagctgaggaataagattaacgagctgagcagagagaaagatgagctgagcagaaagaatgacgagctgaacaatgagaaagatgagctgagcaggaagacagaggagctgagcaaagagagagacaggctgagtgaagacaaacacgagctgagacaggagaaagacaaactgaacaaagagaaaaaggatctgagcacagagaaagaggagctgaagaaagagagagagaagctgagagtattgacagaccaggcagagaagcgatgcagagagagagatgctctgaaaaacttttatgatgccctcatgaaatttgacaattttccagttcgtgatttgtgcccagtatcgttgagaccgaaatgccagcattgcgccaaacatgagaaatcctacaagggacactgctactatatttatccatatgacataggttatgcaaactgggaccgaagtcgacagttgtgtaagactgaaggtggagacttggttgtaattgatgatctggaggagcaggaatttatcaacaatcacacccagaaatacgattctgataaccatggatactggatagggttacatcactttcgacacaattggtcctgggttgatggacgtaggaactttcttgagttctggattgaggggattccccgttcgtcaggagcagcgctgcatatgccacgacaaaaagccacagagagctggagagcagaagacaagatggaagcatccaaattcatctgtgagcgtctggagatttcttggccctttggctaacactgttctcttaaagcttcaatcaagaatactcagcgtgtcatcacattttggtgaatgtcataaataaaagctcaatctctgaaagccaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]