2025-09-18 13:20:07, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_006353963 2871 bp mRNA linear PLN 04-APR-2025 DEFINITION PREDICTED: Solanum tuberosum apoptotic chromatin condensation inducer in the nucleus-like (LOC102581657), transcript variant X2, mRNA. ACCESSION XM_006353963 VERSION XM_006353963.2 DBLINK BioProject: PRJNA225997 KEYWORDS RefSeq. SOURCE Solanum tuberosum (potato) ORGANISM Solanum tuberosum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; asterids; lamiids; Solanales; Solanaceae; Solanoideae; Solaneae; Solanum. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_006239092.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jan 5, 2016 this sequence version replaced XM_006353963.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_000226075.1-RS_2025_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/03/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2871 /organism="Solanum tuberosum" /mol_type="mRNA" /cultivar="DM 1-3 516 R44" /db_xref="taxon:4113" /chromosome="Unknown" gene 1..2871 /gene="LOC102581657" /note="apoptotic chromatin condensation inducer in the nucleus-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 ESTs, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 80 samples with support for all annotated introns" /db_xref="GeneID:102581657" CDS 154..2568 /gene="LOC102581657" /codon_start=1 /product="apoptotic chromatin condensation inducer in the nucleus-like isoform X2" /protein_id="XP_006354025.1" /db_xref="GeneID:102581657" /translation="
MSDYPVLDNLPIDKWKVPALREELKRRNLMTKGLKDDLVNRLNNAIHRERGEPEVEESTEINPDVLEWNNKSMGHPQNKVIKGSDRDTDPANATKVLDEVATGGTDDVSGVREHSEASVGSTSVINEIVSTDQFVEVKIDKKHEVIDSSLNNDVVDEVSGVRYAAIQSSGTVQDIEDMRISSSEGVLEDNLRRQENDAELTPVTSKDALGNNSIKLEDEGLKLSGMDAEYDKSNPDTQVYEVNPDLGSQVKSDTFSTDTLPINENNDLNDNLNADNVKLVTEVVRQEKESSSKDLSDVGSIYPLHDQMPHEMQGHVGETVDDKSSEVKFSMKKANADQVSVAVTKVEHGLESNTLNNSEQKDVQFEKARTLGDVIDPSLSPKKVEVSAEDKHCIAASNDDRKVLSKISEVADDQNMEKINLDQSSADDSMEEDVVETKHVAFDHISKENDKTEESITGMTKEPKVVRNGSSDATQQDNPSEKVESPQESKDGSPELSEKRKFQGDGSKEPAKRQRKWNTENLNTAEPQNSNIALSENLVQTIPVKPIFGRTDSTVSEDAPKERLVPKSSKTATNSLKIENFLRPFTLKAVQELLARTGEVCSFWMDQIKTHCYVTYSSVEEAIETRNAVYNLQWPPKGGRLLVADFVAPQQVQTKIDGREPATPATNRSPAVPPASSSVQAPPAWQQGRKQQVESEHPLMRQPPPAPPTALPIKERLAPPAWQQGRKQQVESEHPLTRQAPPAPPTAPPIKEKLVPPVADKNDPPVITLDDIFRKTKAAPRIYYLPLTDEEVAKKLASRGGAEN"
misc_feature 187..291 /gene="LOC102581657" /note="SAP domain; Region: SAP; pfam02037" /db_xref="CDD:460424" misc_feature 193..>483 /gene="LOC102581657" /note="poly [ADP-ribose] polymerase; Provisional; Region: PLN03124" /db_xref="CDD:215591" misc_feature 1870..2133 /gene="LOC102581657" /note="RNA recognition motif (RRM) found in apoptotic chromatin condensation inducer in the nucleus (acinus) and similar proteins; Region: RRM_ACINU; cd12432" /db_xref="CDD:409866" misc_feature <2434..2550 /gene="LOC102581657" /note="RNSP1-SAP18 binding (RSB) motif; Region: RSB_motif; pfam16294" /db_xref="CDD:465085" ORIGIN
taaaaagggatgaattgacactttttctgctttgatgaatggaaaaaaccctaatgaaacccttcttcgactgaaaaaattcttcttctgctccggaattagggttttcatcaccttctcaggcgagaatcttccgtctcattggtggcgaagatgtcggactatcccgtgcttgataatctccccattgataaatggaaggtaccagcattaagggaagagcttaagaggaggaacttaatgacaaaaggtttgaaggatgatcttgttaatcgattaaataatgctatccacagagaaagaggagaacctgaggttgaagagagtactgaaataaatcccgatgttcttgaatggaataataaaagtatggggcatccccaaaacaaagttattaagggttctgatcgtgatactgatcctgccaatgccaccaaagtcttggatgaggttgcaactgggggtactgatgacgtttctggagtaagagaacattcagaggcttctgttggtagcactagtgttataaatgagattgtgtctactgatcaatttgttgaagtcaaaattgataagaaacacgaggttatcgattcttctctgaacaacgatgttgttgatgaggtatctggagttaggtatgctgctattcagagcagtggcactgtacaggacattgaggatatgcgaatttcatcttctgagggagtgcttgaggataaccttaggagacaagagaatgatgccgagttaaccccagtaacatccaaggatgccttgggaaacaatagcattaagttggaggatgagggtctgaaactctcaggcatggatgctgagtatgataagtccaatccagacactcaggtatatgaggtcaaccctgatttagggtctcaagtaaaatctgacacattttctactgatactttgcccattaatgaaaataatgatttaaatgataatttgaatgctgataatgttaaattagtaactgaagttgttaggcaagagaaggagtcatccagcaaagatctgtcagatgttggtagcatttatccattgcatgatcagatgccacatgagatgcagggtcatgttggagaaactgttgatgacaaatcttcggaggtgaaatttagcatgaaaaaggccaatgcagatcaggtttctgttgctgttaccaaggtagagcatggtttagaaagtaacacattgaataatagtgagcaaaaagatgttcagtttgaaaaagctagaactttaggtgatgttatagaccctagtttgtcacccaagaaagttgaggtatctgctgaagataaacattgtattgctgcttccaatgatgatagaaaagttttgagcaagatatctgaggtagcggatgatcagaatatggaaaagataaatttggatcaatcttcagctgatgattccatggaggaggatgtagtagagacaaagcatgtggcttttgatcatatttctaaggagaatgataagactgaagagtctattacgggaatgacaaaagagcccaaagttgtacgaaatggctcttctgatgcaacgcagcaagacaatccttctgagaaggttgagtctcctcaagaatctaaagatgggtctcctgaattgtcagagaagagaaagtttcaaggagatgggagtaaagagcctgcaaaaaggcagcgcaaatggaacactgagaatttgaatactgctgagccacaaaattcaaatattgcattatcagagaacttggttcagaccatccctgtcaagcctatctttggcaggaccgactctacagttagtgaggatgcacccaaggagcgccttgtaccaaagtcttccaaaacagccactaattctctcaaaattgagaacttcttgcggccctttacactgaaagctgtgcaagagctccttgcaagaactggtgaagtctgcagtttctggatggaccagataaagacccattgctatgtcacgtattcttcggtagaggaagccatagagacccgaaatgctgtttacaacctccaatggccaccaaaaggaggtcgtctcctggttgcagattttgttgctccccaacaggtgcaaaccaagatagacggacgggagcctgctactccagcgacaaatcgcagtcctgcagtgcctccagcttcatcctctgttcaagcaccacctgcttggcagcagggtcgcaaacagcaggttgagtcagaacatccactaatgcgccagccaccacctgctcctcctactgcgctaccaataaaagagaggttggctccacctgcttggcagcagggtcgcaaacaacaggttgagtcagaacatccactcacgcgccaggcaccacctgctcctcctactgcgccaccaataaaagagaagttggttccacctgttgctgataaaaatgacccccctgttattactttggatgacatcttcagaaagaccaaagccgctccccgtatctattatttaccgctgactgatgaagaagttgctaaaaagcttgccagtagaggaggtgctgagaactagagcttttaagtgaacaaaggacttgttagatagatggtatatggagaggtgttgcgatgtaatgctgataactgctaatttaccctcacagagaagttgcagtcttgaggctcacttaagaccttgctttcttttctattttcgttgttaatggttactgcaaggttgaagtctctactgtattttactttgggttgaagaaacataacaaaatgtgcagaatctgccttctttcttcatccagattcatcgttgaattgcgccgtagctgtaaatgccatttatctccattcgttttcttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]