2025-04-05 07:30:18, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_005325744 3592 bp mRNA linear ROD 22-MAR-2021 DEFINITION PREDICTED: Ictidomys tridecemlineatus nuclear factor kappa B subunit 1 (Nfkb1), transcript variant X2, mRNA. ACCESSION XM_005325744 VERSION XM_005325744.3 DBLINK BioProject: PRJNA714113 KEYWORDS RefSeq. SOURCE Ictidomys tridecemlineatus (thirteen-lined ground squirrel) ORGANISM Ictidomys tridecemlineatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciuromorpha; Sciuridae; Xerinae; Marmotini; Ictidomys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024405301.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Mar 22, 2021 this sequence version replaced XM_005325744.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ictidomys tridecemlineatus Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3592 /organism="Ictidomys tridecemlineatus" /mol_type="mRNA" /isolate="GS200" /db_xref="taxon:43179" /chromosome="Unknown" /sex="female" /tissue_type="liver" /collection_date="2010" /collected_by="Sandy Martin, University of Colorado, Anschutz Medical Campus" gene 1..3592 /gene="Nfkb1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 14 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 71 samples with support for all annotated introns" /db_xref="GeneID:101972573" CDS 27..2945 /gene="Nfkb1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X2" /protein_id="XP_005325801.1" /db_xref="GeneID:101972573" /translation="
MAGNNPYGGMPEQIFHLNPLPHTIFNPELFPPEMPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNDVSKRDPEDCGKSGGREIVNLSGNIIKTTEQDKLGMSMDRNEEVTLLCTRGVKEEDSLFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSVLLKHKKAALLIDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMAANWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIKELVEALRQMGYTEAIQVIQAAFCTSEASSPVKTTSQAHSLPFLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTSSSSLLTLNKMPHDYGQEGPIEGKI"
misc_feature 147..752 /gene="Nfkb1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(189..191,195..200,204..209,216..227,450..452, 456..461,750..752) /gene="Nfkb1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 771..1076 /gene="Nfkb1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(774..776,780..788,792..800,918..926,963..965, 999..1001,1056..1058,1065..1067,1071..1073) /gene="Nfkb1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(780..785,789..791,828..830,834..836,840..842, 939..944,951..953,957..959) /gene="Nfkb1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(843..845,849..851,942..947) /gene="Nfkb1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1506..2294 /gene="Nfkb1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature order(1644..1646,1650..1652,1662..1667,1674..1682, 1686..1691,1701..1703,1710..1712,1755..1757,1761..1763, 1767..1769,1779..1784,1791..1799,1803..1808,1818..1820, 1827..1829,1854..1856,1860..1862,1866..1868,1878..1883, 1890..1898,1902..1907,1917..1919,1926..1928) /gene="Nfkb1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1644..1757 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1761..1856 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1968..2060 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2070..2168 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2466..2690 /gene="Nfkb1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
gcgcggacccgccaccaggctccagaatggcaggaaacaatccatacgggggaatgcctgaacaaatatttcacttgaatcctttgcctcatactatatttaatccagaattatttcccccggagatgccactgcctacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtttgtgaaggcccatcccatggcggacttcctggtgcatctagtgagaagaacaagaagtcctaccctcaggttaaaatttgcaactatgtgggacctgcaaaggtgattgttcagttggtcacaaatgggaaaaatatccacctgcacgcccacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgccggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgacagacgcgtgtgtcaggggctacaatccgggacttctcgtgcatcctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcggctcttcagcagactaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcccgacagcaccggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcccccaatgcatccaatttgaaaattgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcggttttatgaagaggaggaaaatggtggagtttgggaaggatttggagatttctcccccacagatgttcatagacaattcgccatcgtcttcaaaaccccaaagtataaagatgtcaacattacaaagccagcctctgtcttcgtccagcttcggagaaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcagatagtttcggcggcggcagtggtgccggggctggaggtggaggcatgttcggtagcggcggtggaggagggagcactggaagtacgggtccagggtacggcttcccgcactatggatttcctacatacggtggaattaccttccaccctggaaccactaaatccaatgctgggctgaagcatggaaccatgaatgatgtatctaaaagggatcctgaagattgtggcaagagtggtggcagagagattgtaaatctctctgggaacattatcaaaaccacagaacaagataaactgggcatgtccatggacagaaatgaggaggtgacgctgctgtgcaccaggggagtaaaggaagaggactctctgtttcaggataacctctttctggagaaggctatgcagcttgccaagcggcatgccaacgcccttttcgactatgcggtgacgggagatgtgaagatgctgctggctgtccagcggcacctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagagatctgctagaagttacatctggtttgatttctgatgacattatcaacatgagaaacgatctgtaccagacgcccttgcacttggcagtgatcactaagcaagaagatgtggtagaggacttgctgagtgccggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtgtcttactcaagcacaaaaaggcagcactacttatcgatcatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaacagcctgccgtgtctgctgctgctggtggccgccggagcagacgtcaatgctcaggagcagaagtccgggcgaacagcactgcacctggctgtggagcatgacaacatctccttggcaggctgcctgctcctggagggagatgcccacgtagacagtaccacctatgatggaactacacccctacacatcgcagccgggagagggtccaccaagctggcagctcttctaaaagcagcaggagcagatcccctggtggagaactttgagcccctttatgacctggatgactcttgggaaaaggcaggagaggacgaaggggttgtgcctggaaccacacccctagacatggccgccaactggcaggtatttgacatcttaaatgggaagccgtatgagccagagtttacatctgaggatttgctggcacaaggagacatgaaacagctgaccgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaataatgctttccggctgagtcctgctccttccaaaactctcatggacaactatgaggtctctggggggaccatcaaagagctggtagaggccctgagacagatgggctacaccgaagcaatccaagtgatccaggcggccttctgcacctcggaagcctccagccccgtgaagaccacctctcaggcccactcactgcctttcttgccttcctctacaaggcagcaaatagatgagcttcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccagcagcagctcattgctaactctcaacaaaatgccccacgattatgggcaggaaggacctatagaaggcaaaatttagccttcgggcagtttcccatgctgtgtaaaccaaagtcctaaaattccactgcattgtccaaaagaaggaaggtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggccgtctaaacgtggcttcctttcctggtttttcaatgagttttagttgattcacttgcagataagtatctagcaatccccctcactgcactgaactgatgtgacctggggatgaggtagtttattgagctttactggctgctgctggattacagttgctttttttgtcgtcattgctgctgtccctctgctgcattcccactgtcattaaagggtgtccccacctggtgttctttctagccgtccagggcacagttgtgcattcagattaaggattaagaaaagaggtgttttaaaatcagagtcacttagtgtgcaattaaaaaagaaaggctcattgctttttctaatgtggttatctcagtgatttggaaaaaagaagaatttatcaatatttaaacatggttataatcagtgccgaaaatgatattttcccctttttctgcattttgctattgtaaatatgtttttttttagatcaaatactttaaaggaaaaatgttggattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]