2024-06-29 19:13:18, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NR_030447 109 bp RNA linear ROD 05-AUG-2023 DEFINITION Mus musculus microRNA 680-1 (Mir680-1), microRNA. ACCESSION NR_030447 VERSION NR_030447.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 109) AUTHORS Prosser HM, Koike-Yusa H, Cooper JD, Law FC and Bradley A. TITLE A resource of vectors and ES cells for targeted deletion of microRNAs in mice JOURNAL Nat Biotechnol 29 (9), 840-845 (2011) PUBMED 21822254 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 109) AUTHORS Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S and Russo T. TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells JOURNAL FASEB J 24 (9), 3255-3263 (2010) PUBMED 20439489 REFERENCE 3 (bases 1 to 109) AUTHORS Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and Yoshikawa T. TITLE The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal muscle in response to physical activity JOURNAL Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010) PUBMED 20086200 REFERENCE 4 (bases 1 to 109) AUTHORS Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M and Kato I. TITLE The expression profile of microRNAs in mouse embryos JOURNAL Nucleic Acids Res 34 (6), 1765-1771 (2006) PUBMED 16582102 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 109) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC171002.2. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-109 AC171002.2 114135-114243 FEATURES Location/Qualifiers source 1..109 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="6" /map="6 63.44 cM" gene 1..109 /gene="Mir680-1" /gene_synonym="Mirn680-1" /note="microRNA 680-1" /db_xref="GeneID:735268" /db_xref="MGI:MGI:3629682" /db_xref="miRBase:MI0004640" precursor_RNA 1..109 /gene="Mir680-1" /gene_synonym="Mirn680-1" /product="microRNA 680-1" /db_xref="GeneID:735268" /db_xref="MGI:MGI:3629682" /db_xref="miRBase:MI0004640" exon 1..109 /gene="Mir680-1" /gene_synonym="Mirn680-1" /inference="alignment:Splign:2.1.0" ncRNA 7..27 /ncRNA_class="miRNA" /gene="Mir680-1" /gene_synonym="Mirn680-1" /product="mmu-miR-680" /db_xref="miRBase:MIMAT0003457" /db_xref="GeneID:735268" /db_xref="MGI:MGI:3629682" /db_xref="miRBase:MI0004640" ORIGIN
agaagtgggcatctgctgacatgggggccgaagtcaggcgccaggaagcgggcactttgcatcttatctccggaacatcgatcctcttgacagccttgggtgtcaggct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]