GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-06-07 15:15:55, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_019264               1541 bp    mRNA    linear   ROD 29-JUL-2024
DEFINITION  Rattus norvegicus protein kinase cAMP-dependent type II regulatory
            subunit alpha (Prkar2a), mRNA.
ACCESSION   NM_019264
VERSION     NM_019264.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1541)
  AUTHORS   Isensee,J., Kaufholz,M., Knape,M.J., Hasenauer,J., Hammerich,H.,
            Gonczarowska-Jorge,H., Zahedi,R.P., Schwede,F., Herberg,F.W. and
            Hucho,T.
  TITLE     PKA-RII subunit phosphorylation precedes activation by cAMP and
            regulates activity termination
  JOURNAL   J Cell Biol 217 (6), 2167-2184 (2018)
   PUBMED   29615473
  REMARK    GeneRIF: RII phosphorylation precedes cAMP binding and controls the
            inactivation by modulating the reassociation involving the
            coordinated action of phosphodiesterases and phosphatases.
REFERENCE   2  (bases 1 to 1541)
  AUTHORS   Burgers,P.P., van der Heyden,M.A., Kok,B., Heck,A.J. and
            Scholten,A.
  TITLE     A systematic evaluation of protein kinase A-A-kinase anchoring
            protein interaction motifs
  JOURNAL   Biochemistry 54 (1), 11-21 (2015)
   PUBMED   25097019
REFERENCE   3  (bases 1 to 1541)
  AUTHORS   Nishimura,T., Fujii,W., Sugiura,K. and Naito,K.
  TITLE     Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
            A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
            porcine full-grown and growing oocytes
  JOURNAL   Biol Reprod 90 (3), 58 (2014)
   PUBMED   24501172
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1541)
  AUTHORS   Biesemann,C., Gronborg,M., Luquet,E., Wichert,S.P., Bernard,V.,
            Bungers,S.R., Cooper,B., Varoqueaux,F., Li,L., Byrne,J.A.,
            Urlaub,H., Jahn,O., Brose,N. and Herzog,E.
  TITLE     Proteomic screening of glutamatergic mouse brain synaptosomes
            isolated by fluorescence activated sorting
  JOURNAL   EMBO J 33 (2), 157-170 (2014)
   PUBMED   24413018
REFERENCE   5  (bases 1 to 1541)
  AUTHORS   Nishimura,T., Sugiura,K. and Naito,K.
  TITLE     A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein
            kinase (PKA) localization and is involved in meiotic maturation of
            porcine oocytes
  JOURNAL   Biol Reprod 88 (4), 85 (2013)
   PUBMED   23426434
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1541)
  AUTHORS   Kultgen,P.L., Byrd,S.K., Ostrowski,L.E. and Milgram,S.L.
  TITLE     Characterization of an A-kinase anchoring protein in human ciliary
            axonemes
  JOURNAL   Mol Biol Cell 13 (12), 4156-4166 (2002)
   PUBMED   12475942
REFERENCE   7  (bases 1 to 1541)
  AUTHORS   Dwivedi,Y., Rizavi,H.S. and Pandey,G.N.
  TITLE     Differential effects of haloperidol and clozapine on [(3)H]cAMP
            binding, protein kinase A (PKA) activity, and mRNA and protein
            expression of selective regulatory and catalytic subunit isoforms
            of PKA in rat brain
  JOURNAL   J Pharmacol Exp Ther 301 (1), 197-209 (2002)
   PUBMED   11907174
REFERENCE   8  (bases 1 to 1541)
  AUTHORS   Marx,S.O., Reiken,S., Hisamatsu,Y., Jayaraman,T., Burkhoff,D.,
            Rosemblit,N. and Marks,A.R.
  TITLE     PKA phosphorylation dissociates FKBP12.6 from the calcium release
            channel (ryanodine receptor): defective regulation in failing
            hearts
  JOURNAL   Cell 101 (4), 365-376 (2000)
   PUBMED   10830164
REFERENCE   9  (bases 1 to 1541)
  AUTHORS   Feliciello,A., Cardone,L., Garbi,C., Ginsberg,M.D., Varrone,S.,
            Rubin,C.S., Avvedimento,E.V. and Gottesman,M.E.
  TITLE     Yotiao protein, a ligand for the NMDA receptor, binds and targets
            cAMP-dependent protein kinase II(1)
  JOURNAL   FEBS Lett 464 (3), 174-178 (1999)
   PUBMED   10618500
REFERENCE   10 (bases 1 to 1541)
  AUTHORS   Scott,J.D., Glaccum,M.B., Zoller,M.J., Uhler,M.D., Helfman,D.M.,
            McKnight,G.S. and Krebs,E.G.
  TITLE     The molecular cloning of a type II regulatory subunit of the
            cAMP-dependent protein kinase from rat skeletal muscle and mouse
            brain
  JOURNAL   Proc Natl Acad Sci U S A 84 (15), 5192-5196 (1987)
   PUBMED   3037538
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF533978.1.
            
            On Aug 31, 2012 this sequence version replaced NM_019264.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF533978.1, J02934.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1541              AF533978.1         5-1545
FEATURES             Location/Qualifiers
     source          1..1541
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q32"
     gene            1..1541
                     /gene="Prkar2a"
                     /note="protein kinase cAMP-dependent type II regulatory
                     subunit alpha"
                     /db_xref="GeneID:29699"
                     /db_xref="RGD:3393"
     exon            1..365
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    44..46
                     /gene="Prkar2a"
                     /note="upstream in-frame stop codon"
     CDS             110..1315
                     /gene="Prkar2a"
                     /EC_number="2.7.11.1"
                     /note="protein kinase, cAMP-dependent, regulatory subunit
                     type II alpha; protein kinase, cAMP-dependent, regulatory,
                     type 2, alpha; protein kinase cAMP-dependent type 2
                     regulatory subunit alpha; protein kinase, cAMP dependent
                     regulatory, type II alpha"
                     /codon_start=1
                     /product="cAMP-dependent protein kinase type II-alpha
                     regulatory subunit"
                     /protein_id="NP_062137.1"
                     /db_xref="GeneID:29699"
                     /db_xref="RGD:3393"
                     /translation="
MSHIQIPPGLTELLQGYTVEVLRQQPPDLVDFAVEYFTRLREARRQESDSFIAPPTTFHAQESSGVPVIEEDGESESDSDDEDLEVPIPSKFTRRVSVCAETFNPDEEEDNDPRVVHPKTDEQRYRLQEACKDILLFKNLDQEQLSQVLDAMFEKIVKTDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNRGSFGELALMYNTPRAATIVATSDGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLFKSLEMSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIRSKTKTNKNGGNQEVEIAHCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSNLDLLDPGQ"
     misc_feature    113..514
                     /gene="Prkar2a"
                     /note="propagated from UniProtKB/Swiss-Prot (P12368.4);
                     Region: Dimerization and phosphorylation"
     misc_feature    113..115
                     /gene="Prkar2a"
                     /note="N-acetylserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); acetylation site"
     misc_feature    119..241
                     /gene="Prkar2a"
                     /note="dimerization/docking (D/D) domain of the Type II
                     alpha Regulatory subunit of cAMP-dependent protein kinase;
                     Region: DD_RIIalpha_PKA; cd12103"
                     /db_xref="CDD:438524"
     misc_feature    order(119..133,137..139,146..151,158..163,170..175,
                     182..184,191..202,206..211,218..223,227..232)
                     /gene="Prkar2a"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:438524"
     misc_feature    order(125..127,137..142,149..154,161..166,173..178)
                     /gene="Prkar2a"
                     /note="AKAP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:438524"
     misc_feature    251..253
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    272..364
                     /gene="Prkar2a"
                     /note="propagated from UniProtKB/Swiss-Prot (P12368.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    332..334
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    338..340
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    398..400
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:16641100,
                     ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    515..853
                     /gene="Prkar2a"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(719..724,749..757)
                     /gene="Prkar2a"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    743..745
                     /gene="Prkar2a"
                     /note="Phosphothreonine, by PDPK1.
                     /evidence=ECO:0000250|UniProtKB:P00515; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    order(815..823,833..841)
                     /gene="Prkar2a"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    881..1246
                     /gene="Prkar2a"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(1109..1114,1139..1147)
                     /gene="Prkar2a"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    1148..1150
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    order(1205..1213,1223..1231)
                     /gene="Prkar2a"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    1283..1285
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     exon            366..401
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            402..451
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            452..535
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            536..642
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            643..796
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            797..898
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            899..973
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            974..1039
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1040..1181
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1182..1541
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cgggccgcgcgggagacctcgggcgcggagtgactggccggcgtgagggagcgcgcaggttgcggccgccggcggccccgacccgccggccctctcagcggtcgccggcatgagccacatccagatcccaccggggctcacggagctgctgcagggctacaccgtggaggtgcttcggcagcagccgcccgacctcgtcgacttcgcggtggagtacttcacacgcctgcgcgaggcccgccgccaggaatcagactcgttcatcgcccccccgacgacctttcacgcgcaggagtccagcggggtccccgtcatcgaggaggacggggagagtgaatcggactcggacgatgaggatctggaagttccgattcccagcaaatttactagacgagtatcagtctgtgcagaaacgtttaaccctgatgaagaagaagataatgatccaagggtggttcaccccaaaaccgacgagcagaggtacagacttcaggaagcctgtaaagacattctgcttttcaaaaacctggatcaggaacagctttctcaagttctggacgccatgtttgaaaagatagtcaaaactgacgagcatgtcattgaccaaggagatgatggagacaacttttatgtcatagaaaggggaacctatgacattttagtaacaaaagataatcaaacacgatctgttggtcagtatgacaaccgtggcagttttggagaactagccctgatgtacaataccccgagagctgctaccattgtggccacctcagacggctccctttggggattggaccgggtgacttttaggagaatcatagtgaagaacaatgcaaagaagaggaagatgttcgaatcgtttattgagtctgtaccgctctttaaatcactagagatgtcagaacgaatgaagattgtggatgtgatcggggaaaagatctataaggatggagagcgaataatcactcagggtgaaaaggccgacagcttttatattatagagtctggagaagtgagcatcttgattagaagcaagactaaaacgaacaagaacggcgggaaccaggaggttgagattgcccactgccataaggggcagtactttggagaacttgccctggtgaccaacaaaccaagagctgcttctgcttatgcggttggagacgtcaaatgcttagtcatggatgttcaagcatttgagaggcttctgggcccctgcatggacatcatgaagaggaacatctcacattacgaagaacagctggtgaagatgtttggctccaacttggatctattggaccccgggcagtagatgtgatgaatctcggagccttctcagtgtgataccaaatccttccagtcagccacaagaacacacccagaaaacagacacgacagaactgcgcctgctgctgtctctgctgctgccatcgctgtggtaaagggcacttagaagtcttgaaagatggacagaggctctacccacacccaccttccactttgcttctgaacgccgtcattagaccacttatgtcacg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]