2025-04-04 14:26:11, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NM_001424326 1712 bp mRNA linear PRI 21-NOV-2024 DEFINITION Homo sapiens cholesin (CHLSN), transcript variant 16, mRNA. ACCESSION NM_001424326 XM_011515583 VERSION NM_001424326.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1712) AUTHORS Ryk,A., Marcinkiewicz,A., Chrzanowski,J., Michalak,A.M., Drozdz,I., Burzynski,J., Krejca,M. and Fendler,W. TITLE Cholesin receptor signalling is active in cardiovascular system-associated adipose tissue and correlates with SGLT2i treatment in patients with diabetes JOURNAL Cardiovasc Diabetol 23 (1), 211 (2024) PUBMED 38902687 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1712) AUTHORS Hu,X., Chen,F., Jia,L., Long,A., Peng,Y., Li,X., Huang,J., Wei,X., Fang,X., Gao,Z., Zhang,M., Liu,X., Chen,Y.G., Wang,Y., Zhang,H. and Wang,Y. TITLE A gut-derived hormone regulates cholesterol metabolism JOURNAL Cell 187 (7), 1685-1700 (2024) PUBMED 38503280 REMARK GeneRIF: A gut-derived hormone regulates cholesterol metabolism. REFERENCE 3 (bases 1 to 1712) AUTHORS Haenig,C., Atias,N., Taylor,A.K., Mazza,A., Schaefer,M.H., Russ,J., Riechers,S.P., Jain,S., Coughlin,M., Fontaine,J.F., Freibaum,B.D., Brusendorf,L., Zenkner,M., Porras,P., Stroedicke,M., Schnoegl,S., Arnsburg,K., Boeddrich,A., Pigazzini,L., Heutink,P., Taylor,J.P., Kirstein,J., Andrade-Navarro,M.A., Sharan,R. and Wanker,E.E. TITLE Interactome Mapping Provides a Network of Neurodegenerative Disease Proteins and Uncovers Widespread Protein Aggregation in Affected Brains JOURNAL Cell Rep 32 (7), 108050 (2020) PUBMED 32814053 REFERENCE 4 (bases 1 to 1712) AUTHORS Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W., Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B., Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A., Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A., Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C., Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M., Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G., Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S., Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A., Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S., Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N., Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A., Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M., Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J., Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P., Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J., Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A. TITLE A reference map of the human binary protein interactome JOURNAL Nature 580 (7803), 402-408 (2020) PUBMED 32296183 REFERENCE 5 (bases 1 to 1712) AUTHORS Meeks,K.A.C., Henneman,P., Venema,A., Addo,J., Bahendeka,S., Burr,T., Danquah,I., Galbete,C., Mannens,M.M.A.M., Mockenhaupt,F.P., Owusu-Dabo,E., Rotimi,C.N., Schulze,M.B., Smeeth,L., Spranger,J., Zafarmand,M.H., Adeyemo,A. and Agyemang,C. TITLE Epigenome-wide association study in whole blood on type 2 diabetes among sub-Saharan African individuals: findings from the RODAM study JOURNAL Int J Epidemiol 48 (1), 58-70 (2019) PUBMED 30107520 REMARK GeneRIF: Three ubiquitous methylation loci were consistently and strongly associated with type 2 diabetes in Ghanaians: TXNIP, C7orf50 and CPT1A REFERENCE 6 (bases 1 to 1712) AUTHORS Willer,C.J., Schmidt,E.M., Sengupta,S., Peloso,G.M., Gustafsson,S., Kanoni,S., Ganna,A., Chen,J., Buchkovich,M.L., Mora,S., Beckmann,J.S., Bragg-Gresham,J.L., Chang,H.Y., Demirkan,A., Den Hertog,H.M., Do,R., Donnelly,L.A., Ehret,G.B., Esko,T., Feitosa,M.F., Ferreira,T., Fischer,K., Fontanillas,P., Fraser,R.M., Freitag,D.F., Gurdasani,D., Heikkila,K., Hypponen,E., Isaacs,A., Jackson,A.U., Johansson,A., Johnson,T., Kaakinen,M., Kettunen,J., Kleber,M.E., Li,X., Luan,J., Lyytikainen,L.P., Magnusson,P.K.E., Mangino,M., Mihailov,E., Montasser,M.E., Muller-Nurasyid,M., Nolte,I.M., O'Connell,J.R., Palmer,C.D., Perola,M., Petersen,A.K., Sanna,S., Saxena,R., Service,S.K., Shah,S., Shungin,D., Sidore,C., Song,C., Strawbridge,R.J., Surakka,I., Tanaka,T., Teslovich,T.M., Thorleifsson,G., Van den Herik,E.G., Voight,B.F., Volcik,K.A., Waite,L.L., Wong,A., Wu,Y., Zhang,W., Absher,D., Asiki,G., Barroso,I., Been,L.F., Bolton,J.L., Bonnycastle,L.L., Brambilla,P., Burnett,M.S., Cesana,G., Dimitriou,M., Doney,A.S.F., Doring,A., Elliott,P., Epstein,S.E., Ingi Eyjolfsson,G., Gigante,B., Goodarzi,M.O., Grallert,H., Gravito,M.L., Groves,C.J., Hallmans,G., Hartikainen,A.L., Hayward,C., Hernandez,D., Hicks,A.A., Holm,H., Hung,Y.J., Illig,T., Jones,M.R., Kaleebu,P., Kastelein,J.J.P., Khaw,K.T., Kim,E., Klopp,N., Komulainen,P., Kumari,M., Langenberg,C., Lehtimaki,T., Lin,S.Y., Lindstrom,J., Loos,R.J.F., Mach,F., McArdle,W.L., Meisinger,C., Mitchell,B.D., Muller,G., Nagaraja,R., Narisu,N., Nieminen,T.V.M., Nsubuga,R.N., Olafsson,I., Ong,K.K., Palotie,A., Papamarkou,T., Pomilla,C., Pouta,A., Rader,D.J., Reilly,M.P., Ridker,P.M., Rivadeneira,F., Rudan,I., Ruokonen,A., Samani,N., Scharnagl,H., Seeley,J., Silander,K., Stancakova,A., Stirrups,K., Swift,A.J., Tiret,L., Uitterlinden,A.G., van Pelt,L.J., Vedantam,S., Wainwright,N., Wijmenga,C., Wild,S.H., Willemsen,G., Wilsgaard,T., Wilson,J.F., Young,E.H., Zhao,J.H., Adair,L.S., Arveiler,D., Assimes,T.L., Bandinelli,S., Bennett,F., Bochud,M., Boehm,B.O., Boomsma,D.I., Borecki,I.B., Bornstein,S.R., Bovet,P., Burnier,M., Campbell,H., Chakravarti,A., Chambers,J.C., Chen,Y.I., Collins,F.S., Cooper,R.S., Danesh,J., Dedoussis,G., de Faire,U., Feranil,A.B., Ferrieres,J., Ferrucci,L., Freimer,N.B., Gieger,C., Groop,L.C., Gudnason,V., Gyllensten,U., Hamsten,A., Harris,T.B., Hingorani,A., Hirschhorn,J.N., Hofman,A., Hovingh,G.K., Hsiung,C.A., Humphries,S.E., Hunt,S.C., Hveem,K., Iribarren,C., Jarvelin,M.R., Jula,A., Kahonen,M., Kaprio,J., Kesaniemi,A., Kivimaki,M., Kooner,J.S., Koudstaal,P.J., Krauss,R.M., Kuh,D., Kuusisto,J., Kyvik,K.O., Laakso,M., Lakka,T.A., Lind,L., Lindgren,C.M., Martin,N.G., Marz,W., McCarthy,M.I., McKenzie,C.A., Meneton,P., Metspalu,A., Moilanen,L., Morris,A.D., Munroe,P.B., Njolstad,I., Pedersen,N.L., Power,C., Pramstaller,P.P., Price,J.F., Psaty,B.M., Quertermous,T., Rauramaa,R., Saleheen,D., Salomaa,V., Sanghera,D.K., Saramies,J., Schwarz,P.E.H., Sheu,W.H., Shuldiner,A.R., Siegbahn,A., Spector,T.D., Stefansson,K., Strachan,D.P., Tayo,B.O., Tremoli,E., Tuomilehto,J., Uusitupa,M., van Duijn,C.M., Vollenweider,P., Wallentin,L., Wareham,N.J., Whitfield,J.B., Wolffenbuttel,B.H.R., Ordovas,J.M., Boerwinkle,E., Palmer,C.N.A., Thorsteinsdottir,U., Chasman,D.I., Rotter,J.I., Franks,P.W., Ripatti,S., Cupples,L.A., Sandhu,M.S., Rich,S.S., Boehnke,M., Deloukas,P., Kathiresan,S., Mohlke,K.L., Ingelsson,E. and Abecasis,G.R. CONSRTM Global Lipids Genetics Consortium TITLE Discovery and refinement of loci associated with lipid levels JOURNAL Nat Genet 45 (11), 1274-1283 (2013) PUBMED 24097068 REFERENCE 7 (bases 1 to 1712) AUTHORS Castello,A., Fischer,B., Eichelbaum,K., Horos,R., Beckmann,B.M., Strein,C., Davey,N.E., Humphreys,D.T., Preiss,T., Steinmetz,L.M., Krijgsveld,J. and Hentze,M.W. TITLE Insights into RNA biology from an atlas of mammalian mRNA-binding proteins JOURNAL Cell 149 (6), 1393-1406 (2012) PUBMED 22658674 REFERENCE 8 (bases 1 to 1712) AUTHORS Yashin,A.I., Wu,D., Arbeev,K.G. and Ukraintseva,S.V. TITLE Joint influence of small-effect genetic variants on human longevity JOURNAL Aging (Albany NY) 2 (9), 612-620 (2010) PUBMED 20834067 REFERENCE 9 (bases 1 to 1712) AUTHORS Satoh,J., Obayashi,S., Misawa,T., Sumiyoshi,K., Oosumi,K. and Tabunoki,H. TITLE Protein microarray analysis identifies human cellular prion protein interactors JOURNAL Neuropathol Appl Neurobiol 35 (1), 16-35 (2009) PUBMED 18482256 REFERENCE 10 (bases 1 to 1712) AUTHORS Oh,J.H., Yang,J.O., Hahn,Y., Kim,M.R., Byun,S.S., Jeon,Y.J., Kim,J.M., Song,K.S., Noh,S.M., Kim,S., Yoo,H.S., Kim,Y.S. and Kim,N.S. TITLE Transcriptome analysis of human gastric cancer JOURNAL Mamm Genome 16 (12), 942-954 (2005) PUBMED 16341674 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC091729.4 and AC073957.7. On Sep 22, 2023 this sequence version replaced XM_011515583.3. ##Evidence-Data-START## Transcript exon combination :: SRR18074967.3104662.1, SRR14038193.3696447.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA1965299, SAMEA1966682 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-49 AC091729.4 65055-65103 c 50-179 AC091729.4 54113-54242 c 180-373 AC073957.7 131010-131203 c 374-455 AC073957.7 121530-121611 c 456-614 AC073957.7 118706-118864 c 615-1712 AC073957.7 99024-100121 c FEATURES Location/Qualifiers source 1..1712 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7p22.3" gene 1..1712 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="cholesin" /db_xref="GeneID:84310" /db_xref="HGNC:HGNC:22421" exon 1..49 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /inference="alignment:Splign:2.1.0" exon 50..179 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /inference="alignment:Splign:2.1.0" CDS 51..728 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="isoform e is encoded by transcript variant 16; uncharacterized protein C7orf50; protein cholesin" /codon_start=1 /product="protein cholesin isoform e" /protein_id="NP_001411255.1" /db_xref="GeneID:84310" /db_xref="HGNC:HGNC:22421" /translation="
MAKQKRKVPEVTEKKNKKLKKASAEGPLLGPEAAPSGEGAGSKGEAVLRPGLDAEPELSPEEQRVLERKLKKERKKEERQRLREAGLVAQHPPARRSGAELALDYLCRWAQKHKNWRFQKTRQTWLLLHMYDSDKVPDEHFSTLLAYLEGLQGRARELTVQKAEALMRELDEEGSDPPLPGRAQRIRQDTCAVDPAAMLWGSPAARRGAHVEGNPGPRNRGQAST"
misc_feature 51..299 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 117..119 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:18669648; propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site" misc_feature 225..227 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:20068231, ECO:0007744|PubMed:21406692, ECO:0007744|PubMed:23186163; propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site" misc_feature 339..341 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:18669648, ECO:0007744|PubMed:20068231; propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site" misc_feature 573..575 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:21406692, ECO:0007744|PubMed:23186163; propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site" exon 180..373 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /inference="alignment:Splign:2.1.0" exon 374..455 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /inference="alignment:Splign:2.1.0" exon 456..614 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /inference="alignment:Splign:2.1.0" exon 615..1712 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /inference="alignment:Splign:2.1.0" regulatory 1690..1695 /regulatory_class="polyA_signal_sequence" /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="hexamer: AATAAA" polyA_site 1712 /gene="CHLSN" /gene_synonym="C7orf50; YCR016W" /note="major polyA site" ORIGIN
ggcgtccgcgacgcagctgttcacgcttaggtgggcgacgtgggcgcaggatggcaaaacagaagagaaaagttcctgaagtgacagagaaaaagaacaaaaagctgaagaaggcgtcagcagaggggccactgctgggccctgaggctgcaccaagtggcgaaggagccggctccaagggcgaagctgtgctcaggcccgggctggacgcagagccagagctgtccccagaggagcagagggtcctggaaaggaagctgaaaaaggaacggaagaaagaggagaggcagcgtctgcgggaggcaggccttgtggcccagcacccgcctgccaggcgctcgggggccgaactggccctggactacctctgcagatgggcccaaaagcacaagaactggaggtttcagaagacgaggcagacgtggctcctgctgcacatgtatgacagtgacaaggttcccgatgagcacttctccaccctgctggcctacctggaggggctgcagggccgggcccgagagctgacggtgcagaaggcggaagccctgatgcgggagctggatgaggagggctctgatccccccctgccggggagggcccagcgcatccgacaggacacctgtgccgtggacccagccgccatgctgtggggaagcccagcagctcgtagaggggcccatgtggaggggaacccaggcccacggaaccgtggccaggcttccacatgacactgagcccacctgcctgccagccacgtgtgccatcgtgagtggatcctccagtccgaagtggagctaacccggcccaggcctcgtggaatgtctccaccaagccctgcccaagtgcaagtgcaagttcacgggtaatgactgctgctaagcttggggtgctttgttatgcagcggcagataacgcgaacacggccacgtaagcttcagcaagggctgtgaccccttgagtctgtttctctgtgtcagatgaggataataagacctacttagctggattcattcatcttcgagctataaacggagcatgtccagcgtgccaggcactgctccaggctctggggatccgggtggaaatacctgcaataccttgattgctggggctcaaacaaggttcgttccctcctctgagcttttccttttttcttgtagacaaggtctcacttttttgcccaggctgcagtgcagtggtgcgatcttggttcactgcagcctcgacctcccagggctcagacgatcctcccacctcagcctctggggtagctgggaccacaggtgtgcgcccctacacctggctaatttttgtattttttatagacgtagggtttcagcatgttgccaaggctggtctcaaactcctgggctcaagtggtccgcccacctcggcttcccagagtgttgggattacaggtgtgagccaccgcccccagccccttccccactttttacaccggtgaactgctcataaaaattctttcctcttctctcccagctaaagatctcatataaagcaataatcatttgccaggtgacagtcaattaaaagccggttgtcacctccaggccacaggtccctcggggctcccagacagagaggcttagggcagccccaacggaggggctgtccttccactgctaagcggctgctgcagtcaagtgagtgagcgcttctttgctgggtaataaaagctcccattgttcaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]