2025-04-04 14:30:11, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NM_001412258 2270 bp mRNA linear PRI 29-OCT-2024 DEFINITION Homo sapiens sialic acid binding Ig like lectin 12 (SIGLEC12), transcript variant 3, mRNA. ACCESSION NM_001412258 VERSION NM_001412258.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2270) AUTHORS Cuello,H.A., Sinha,S., Verhagen,A.L., Varki,N., Varki,A. and Ghosh,P. TITLE Human-specific elimination of epithelial Siglec-XII suppresses the risk of inflammation-driven colorectal cancers JOURNAL JCI Insight 9 (16), e181539 (2024) PUBMED 38990656 REMARK GeneRIF: Human-specific elimination of epithelial Siglec-XII suppresses the risk of inflammation-driven colorectal cancers. Publication Status: Online-Only REFERENCE 2 (bases 1 to 2270) AUTHORS Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W., Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B., Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A., Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A., Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C., Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M., Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G., Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S., Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A., Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S., Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N., Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A., Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M., Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J., Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P., Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J., Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A. TITLE A reference map of the human binary protein interactome JOURNAL Nature 580 (7803), 402-408 (2020) PUBMED 32296183 REFERENCE 3 (bases 1 to 2270) AUTHORS McDonough,C.W., Gong,Y., Padmanabhan,S., Burkley,B., Langaee,T.Y., Melander,O., Pepine,C.J., Dominiczak,A.F., Cooper-Dehoff,R.M. and Johnson,J.A. TITLE Pharmacogenomic association of nonsynonymous SNPs in SIGLEC12, A1BG, and the selectin region and cardiovascular outcomes JOURNAL Hypertension 62 (1), 48-54 (2013) PUBMED 23690342 REMARK GeneRIF: cardiovascular outcomes may differ based on SIGLEC12 genotype, and antihypertensive treatment strategy. REFERENCE 4 (bases 1 to 2270) AUTHORS Mitra,N., Banda,K., Altheide,T.K., Schaffer,L., Johnson-Pais,T.L., Beuten,J., Leach,R.J., Angata,T., Varki,N. and Varki,A. TITLE SIGLEC12, a human-specific segregating (pseudo)gene, encodes a signaling molecule expressed in prostate carcinomas JOURNAL J Biol Chem 286 (26), 23003-23011 (2011) PUBMED 21555517 REMARK GeneRIF: SIGLEC12, a human-specific segregating (pseudo)gene, encodes a signaling molecule expressed in prostate carcinomas. REFERENCE 5 (bases 1 to 2270) AUTHORS Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V., Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 6 (bases 1 to 2270) AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J., Snippe,H., Hibberd,M.L. and Seielstad,M. TITLE New genetic associations detected in a host response study to hepatitis B vaccine JOURNAL Genes Immun 11 (3), 232-238 (2010) PUBMED 20237496 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 7 (bases 1 to 2270) AUTHORS Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C., Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R., Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A., Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C., Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S., Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N., Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am J Hum Genet 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 8 (bases 1 to 2270) AUTHORS Angata,T., Varki,N.M. and Varki,A. TITLE A second uniquely human mutation affecting sialic acid biology JOURNAL J Biol Chem 276 (43), 40282-40287 (2001) PUBMED 11546777 REFERENCE 9 (bases 1 to 2270) AUTHORS Yu,Z., Lai,C.M., Maoui,M., Banville,D. and Shen,S.H. TITLE Identification and characterization of S2V, a novel putative siglec that contains two V set Ig-like domains and recruits protein-tyrosine phosphatases SHPs JOURNAL J Biol Chem 276 (26), 23816-23824 (2001) PUBMED 11328818 REFERENCE 10 (bases 1 to 2270) AUTHORS Foussias,G., Taylor,S.M., Yousef,G.M., Tropak,M.B., Ordon,M.H. and Diamandis,E.P. TITLE Cloning and molecular characterization of two splice variants of a new putative member of the Siglec-3-like subgroup of Siglecs JOURNAL Biochem Biophys Res Commun 284 (4), 887-899 (2001) PUBMED 11409877 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CP068259.2. Summary: Sialic acid-binding immunoglobulin-like lectins (SIGLECs) are a family of cell surface proteins belonging to the immunoglobulin superfamily. They mediate protein-carbohydrate interactions by selectively binding to different sialic acid moieties present on glycolipids and glycoproteins. This gene encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members of this subfamily are characterized by an extracellular V-set immunoglobulin-like domain followed by two C2-set immunoglobulin-like domains, and the cytoplasmic tyrosine-based motifs ITIM and SLAM-like. The encoded protein, upon tyrosine phosphorylation, has been shown to recruit the Src homology 2 domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It has been suggested that the protein is involved in the negative regulation of macrophage signaling by functioning as an inhibitory receptor. This gene is located in a cluster with other SIGLEC3-like genes on 19q13.4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]. Transcript Variant: This variant (3) uses the same exon combination as variant 1 but represents the allele encoded by the T2T-CHM13v2.0 genome assembly. The encoded isoform (c) has a shorter and frameshifted N-terminus compared to isoform a. ##Evidence-Data-START## Transcript exon combination :: AY358140.1, BC035809.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA1965299, SAMEA1966682 [ECO:0006172] ##Evidence-Data-END## ##RefSeq-Attributes-START## polymorphic pseudogene :: PMID: 21555517 ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-495 CP068259.2 54589933-54590427 c 496-876 CP068259.2 54588546-54588926 c 877-1155 CP068259.2 54588064-54588342 c 1156-1203 CP068259.2 54587796-54587843 c 1204-1473 CP068259.2 54586644-54586913 c 1474-1570 CP068259.2 54585975-54586071 c 1571-1667 CP068259.2 54585506-54585602 c 1668-2270 CP068259.2 54579849-54580451 c FEATURES Location/Qualifiers source 1..2270 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.41" gene 1..2270 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="sialic acid binding Ig like lectin 12" /db_xref="GeneID:89858" /db_xref="HGNC:HGNC:15482" /db_xref="MIM:606094" exon 1..495 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" misc_feature 162..164 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="upstream in-frame stop codon" CDS 219..1856 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="isoform c is encoded by transcript variant 3; SIGLEC-like 1; sialic acid-binding Ig-like lectin-like 1" /codon_start=1 /product="sialic acid-binding Ig-like lectin 12 isoform c" /protein_id="NP_001399187.1" /db_xref="GeneID:89858" /db_xref="HGNC:HGNC:15482" /db_xref="MIM:606094" /translation="
MAGLPPIQFMATGSGAGDHVSRNIPVATNNPVRAVQEETRDRFHLLGDPQNKDCTLSIRDTRESDAGTYVFCVERGNMKWNYKYDQLSVNVTASQDLLSRYRLEVPESVTVQEGLCVSVPCSVLYPHYNWTASSPVYGSWFKEGADIPWDIPVATNTPSGKVQEDTQGRFLLLGDPQTNNCSLSIRDARKGDSGKYYFQVERGSRKWNYIYDKLSVHVTALTHMPTFSIPGTLESGHPRNLTCSVPWACEQGTPPTITWMGASVSSLDPTITRSSMLSLIPQPQDHGTSLTCQVTLPGAGVTMTRAVRLNISYPPQNLTMTVFQGDGTASTTLRNGSALSVLEGQSLYLVCAVDSNPPARLSWTWGSLTLSPSQSSNLGVLELPRVHVKDEGEFTCRAQNPLGSQHISLSLSLQNEYTGKMRPISGVMLGAFGGAGATALVFLSFCIIFVVVRSCRKKSARPAVGVGDTGMEDANAVRGSASQGPLIESPADDSPPHHAPPALATPSPEEGEIQYASLSFHKARPQYPQEQEAIGYEYSEINIPK"
misc_feature <291..494 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 378..392 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 420..437 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 459..479 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 519..875 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Immunoglobulin Variable (IgV) domain at the N-terminus of CD33 and related Siglecs (sialic acid-binding Ig-like lectins); Region: IgV_CD33; cd05712" /db_xref="CDD:409377" misc_feature 519..593 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="FR1 [structural motif]; Region: FR1" /db_xref="CDD:409377" misc_feature 519..533 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409377" misc_feature 540..554 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409377" misc_feature 558..593 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409377" misc_feature 594..623 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="CDR1 [structural motif]; Region: CDR1" /db_xref="CDD:409377" misc_feature 624..647 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="FR2 [structural motif]; Region: FR2" /db_xref="CDD:409377" misc_feature 624..647 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409377" misc_feature 648..719 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="CDR2 [structural motif]; Region: CDR2" /db_xref="CDD:409377" misc_feature 678..689 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409377" misc_feature 720..821 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="FR3 [structural motif]; Region: FR3" /db_xref="CDD:409377" misc_feature 723..737 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409377" misc_feature 753..779 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409377" misc_feature 798..824 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409377" misc_feature order(813..815,837..842) /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:409377" misc_feature 834..875 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="FR4 [structural motif]; Region: FR4" /db_xref="CDD:409377" misc_feature 834..875 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409377" misc_feature 891..1148 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 933..947 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409579" misc_feature 984..998 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409579" misc_feature 1041..1055 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409579" misc_feature 1083..1100 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409579" misc_feature 1128..1139 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409579" misc_feature 1224..1460 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1257..1271 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1296..1310 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1362..1376 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1395..1412 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1440..1451 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" exon 496..876 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" exon 877..1155 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" exon 1156..1203 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" exon 1204..1473 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" exon 1474..1570 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" exon 1571..1667 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" exon 1668..2270 /gene="SIGLEC12" /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG" /inference="alignment:Splign:2.1.0" ORIGIN
agttcctgagagaagaaccctgaggaacagacttacctcagcaaccctggcacctccaacccgacacatgctactgctgctgctactgctgccacccctgctctgtgggagagtgggggctaaggaacagaaggattacctgctgacaatgcagaagtccgtgacggtgcaggagggcctgtgtgtctctgtgctttgctccttctcctacccccaaaatggctggactgcctccgatccagttcatggctactggttcaggggcaggggaccatgtaagccggaacattccagtggccacaaacaacccagttcgagcagtgcaggaggagactcgggaccgattccacctccttggggacccacagaacaaggattgtaccctgagcatcagagacaccagagagagtgatgcagggacatacgtcttttgtgtagagagaggaaatatgaaatggaattataaatatgaccagctctctgtgaatgtgacagcgtcccaggacctactgtcaagatacaggctggaggtgccagagtcggtgactgtgcaggagggtctgtgtgtctctgtgccctgcagtgtcctttacccccattacaactggactgcctctagccctgtttatggatcctggttcaaggaaggggccgatataccatgggatattccagtggccacaaacaccccaagtggaaaagtgcaagaggatacccagggtcgattcctcctccttggggacccacagaccaacaactgctccctgagcatcagagatgccaggaagggggattcagggaagtactacttccaggtggagagaggaagcaggaaatggaactacatatatgacaagctctctgtgcatgtgacagccctgactcacatgcccaccttctccatcccggggaccctggagtctggccaccccaggaacctgacctgctctgtgccctgggcctgtgaacaggggacgccccccacgatcacctggatgggggcctccgtgtcctccctggaccccactatcactcgctcctcgatgctcagcctcatcccacagccccaggaccatggcaccagcctcacctgtcaggtgaccttgcctggggccggtgtgaccatgaccagggctgtccgactcaacatatcctatcctcctcagaacttgaccatgactgtcttccaaggagatggcacagcatccacaaccttgaggaatggctcggccctttcagtcctggagggccagtccctgtaccttgtctgtgctgtcgacagcaatccccctgccaggctgagctggacctgggggagcctgaccctgagcccctcacagtcctcgaaccttggggtgctggagctgcctcgagtgcatgtgaaggatgaaggggaattcacctgccgagctcagaaccctctaggctcccagcacatttccctgagcctctccctgcaaaacgagtacacaggcaaaatgaggcctatatcaggagtgatgctaggggcattcgggggagctggagccacagccctggtcttcctgtccttctgcatcatcttcgttgtagtgaggtcctgcaggaagaaatcggcaaggccagcagtgggcgtgggggatacaggcatggaggacgcaaacgctgtcaggggctcagcctctcagggacccctgattgaatccccggcagatgacagccccccacaccatgctccgccagccctggccaccccctccccagaggaaggagagatccagtatgcatccctcagcttccacaaagcgaggcctcagtacccacaggaacaggaggccatcggctatgagtactccgagatcaacatccccaagtgagaaactgcagagactcaggcctgtttgagggctcacgacccctgcagcaaagaagcccgagactgattcctttagaattaacagccctccatgctgtgcaacaggacatcagaacttattcctcttgtcaaactgaaaatgcgtgcctgatgaccaaactctccctttctccatccaatcggtccacactccccgcccccggcctctggtacccaccattctcttctctacttctctgaggtcgactattttaggttccaaatatagtgagatcgtagagtgtttgtctctctgtacctggcttatttcactcaacataatgttctctaggttcatccgtgttgttccaaataacagaataatgtattgaatatttcaaaatggctaaaagagaggagtttaaatgttgtcacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]