GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:30:11, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_001412258            2270 bp    mRNA    linear   PRI 29-OCT-2024
DEFINITION  Homo sapiens sialic acid binding Ig like lectin 12 (SIGLEC12),
            transcript variant 3, mRNA.
ACCESSION   NM_001412258
VERSION     NM_001412258.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2270)
  AUTHORS   Cuello,H.A., Sinha,S., Verhagen,A.L., Varki,N., Varki,A. and
            Ghosh,P.
  TITLE     Human-specific elimination of epithelial Siglec-XII suppresses the
            risk of inflammation-driven colorectal cancers
  JOURNAL   JCI Insight 9 (16), e181539 (2024)
   PUBMED   38990656
  REMARK    GeneRIF: Human-specific elimination of epithelial Siglec-XII
            suppresses the risk of inflammation-driven colorectal cancers.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2270)
  AUTHORS   Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W.,
            Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B.,
            Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A.,
            Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A.,
            Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C.,
            Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M.,
            Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G.,
            Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S.,
            Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A.,
            Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S.,
            Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N.,
            Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A.,
            Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M.,
            Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J.,
            Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P.,
            Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J.,
            Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   3  (bases 1 to 2270)
  AUTHORS   McDonough,C.W., Gong,Y., Padmanabhan,S., Burkley,B., Langaee,T.Y.,
            Melander,O., Pepine,C.J., Dominiczak,A.F., Cooper-Dehoff,R.M. and
            Johnson,J.A.
  TITLE     Pharmacogenomic association of nonsynonymous SNPs in SIGLEC12,
            A1BG, and the selectin region and cardiovascular outcomes
  JOURNAL   Hypertension 62 (1), 48-54 (2013)
   PUBMED   23690342
  REMARK    GeneRIF: cardiovascular outcomes may differ based on SIGLEC12
            genotype, and antihypertensive treatment strategy.
REFERENCE   4  (bases 1 to 2270)
  AUTHORS   Mitra,N., Banda,K., Altheide,T.K., Schaffer,L., Johnson-Pais,T.L.,
            Beuten,J., Leach,R.J., Angata,T., Varki,N. and Varki,A.
  TITLE     SIGLEC12, a human-specific segregating (pseudo)gene, encodes a
            signaling molecule expressed in prostate carcinomas
  JOURNAL   J Biol Chem 286 (26), 23003-23011 (2011)
   PUBMED   21555517
  REMARK    GeneRIF: SIGLEC12, a human-specific segregating (pseudo)gene,
            encodes a signaling molecule expressed in prostate carcinomas.
REFERENCE   5  (bases 1 to 2270)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   6  (bases 1 to 2270)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 2270)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am J Hum Genet 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   8  (bases 1 to 2270)
  AUTHORS   Angata,T., Varki,N.M. and Varki,A.
  TITLE     A second uniquely human mutation affecting sialic acid biology
  JOURNAL   J Biol Chem 276 (43), 40282-40287 (2001)
   PUBMED   11546777
REFERENCE   9  (bases 1 to 2270)
  AUTHORS   Yu,Z., Lai,C.M., Maoui,M., Banville,D. and Shen,S.H.
  TITLE     Identification and characterization of S2V, a novel putative siglec
            that contains two V set Ig-like domains and recruits
            protein-tyrosine phosphatases SHPs
  JOURNAL   J Biol Chem 276 (26), 23816-23824 (2001)
   PUBMED   11328818
REFERENCE   10 (bases 1 to 2270)
  AUTHORS   Foussias,G., Taylor,S.M., Yousef,G.M., Tropak,M.B., Ordon,M.H. and
            Diamandis,E.P.
  TITLE     Cloning and molecular characterization of two splice variants of a
            new putative member of the Siglec-3-like subgroup of Siglecs
  JOURNAL   Biochem Biophys Res Commun 284 (4), 887-899 (2001)
   PUBMED   11409877
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from CP068259.2.
            
            Summary: Sialic acid-binding immunoglobulin-like lectins (SIGLECs)
            are a family of cell surface proteins belonging to the
            immunoglobulin superfamily. They mediate protein-carbohydrate
            interactions by selectively binding to different sialic acid
            moieties present on glycolipids and glycoproteins. This gene
            encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members
            of this subfamily are characterized by an extracellular V-set
            immunoglobulin-like domain followed by two C2-set
            immunoglobulin-like domains, and the cytoplasmic tyrosine-based
            motifs ITIM and SLAM-like. The encoded protein, upon tyrosine
            phosphorylation, has been shown to recruit the Src homology 2
            domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It
            has been suggested that the protein is involved in the negative
            regulation of macrophage signaling by functioning as an inhibitory
            receptor. This gene is located in a cluster with other SIGLEC3-like
            genes on 19q13.4. Alternative splicing results in multiple
            transcript variants. [provided by RefSeq, Aug 2013].
            
            Transcript Variant: This variant (3) uses the same exon combination
            as variant 1 but represents the allele encoded by the T2T-CHM13v2.0
            genome assembly. The encoded isoform (c) has a shorter and
            frameshifted N-terminus compared to isoform a.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY358140.1, BC035809.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            polymorphic pseudogene :: PMID: 21555517
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-495               CP068259.2         54589933-54590427   c
            496-876             CP068259.2         54588546-54588926   c
            877-1155            CP068259.2         54588064-54588342   c
            1156-1203           CP068259.2         54587796-54587843   c
            1204-1473           CP068259.2         54586644-54586913   c
            1474-1570           CP068259.2         54585975-54586071   c
            1571-1667           CP068259.2         54585506-54585602   c
            1668-2270           CP068259.2         54579849-54580451   c
FEATURES             Location/Qualifiers
     source          1..2270
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.41"
     gene            1..2270
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="sialic acid binding Ig like lectin 12"
                     /db_xref="GeneID:89858"
                     /db_xref="HGNC:HGNC:15482"
                     /db_xref="MIM:606094"
     exon            1..495
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    162..164
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="upstream in-frame stop codon"
     CDS             219..1856
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="isoform c is encoded by transcript variant 3;
                     SIGLEC-like 1; sialic acid-binding Ig-like lectin-like 1"
                     /codon_start=1
                     /product="sialic acid-binding Ig-like lectin 12 isoform c"
                     /protein_id="NP_001399187.1"
                     /db_xref="GeneID:89858"
                     /db_xref="HGNC:HGNC:15482"
                     /db_xref="MIM:606094"
                     /translation="
MAGLPPIQFMATGSGAGDHVSRNIPVATNNPVRAVQEETRDRFHLLGDPQNKDCTLSIRDTRESDAGTYVFCVERGNMKWNYKYDQLSVNVTASQDLLSRYRLEVPESVTVQEGLCVSVPCSVLYPHYNWTASSPVYGSWFKEGADIPWDIPVATNTPSGKVQEDTQGRFLLLGDPQTNNCSLSIRDARKGDSGKYYFQVERGSRKWNYIYDKLSVHVTALTHMPTFSIPGTLESGHPRNLTCSVPWACEQGTPPTITWMGASVSSLDPTITRSSMLSLIPQPQDHGTSLTCQVTLPGAGVTMTRAVRLNISYPPQNLTMTVFQGDGTASTTLRNGSALSVLEGQSLYLVCAVDSNPPARLSWTWGSLTLSPSQSSNLGVLELPRVHVKDEGEFTCRAQNPLGSQHISLSLSLQNEYTGKMRPISGVMLGAFGGAGATALVFLSFCIIFVVVRSCRKKSARPAVGVGDTGMEDANAVRGSASQGPLIESPADDSPPHHAPPALATPSPEEGEIQYASLSFHKARPQYPQEQEAIGYEYSEINIPK"
     misc_feature    <291..494
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    378..392
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    420..437
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    459..479
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    519..875
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Immunoglobulin Variable (IgV) domain at the
                     N-terminus of CD33 and related Siglecs (sialic
                     acid-binding Ig-like lectins); Region: IgV_CD33; cd05712"
                     /db_xref="CDD:409377"
     misc_feature    519..593
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="FR1 [structural motif]; Region: FR1"
                     /db_xref="CDD:409377"
     misc_feature    519..533
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409377"
     misc_feature    540..554
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409377"
     misc_feature    558..593
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409377"
     misc_feature    594..623
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="CDR1 [structural motif]; Region: CDR1"
                     /db_xref="CDD:409377"
     misc_feature    624..647
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="FR2 [structural motif]; Region: FR2"
                     /db_xref="CDD:409377"
     misc_feature    624..647
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409377"
     misc_feature    648..719
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="CDR2 [structural motif]; Region: CDR2"
                     /db_xref="CDD:409377"
     misc_feature    678..689
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409377"
     misc_feature    720..821
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="FR3 [structural motif]; Region: FR3"
                     /db_xref="CDD:409377"
     misc_feature    723..737
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409377"
     misc_feature    753..779
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409377"
     misc_feature    798..824
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409377"
     misc_feature    order(813..815,837..842)
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:409377"
     misc_feature    834..875
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="FR4 [structural motif]; Region: FR4"
                     /db_xref="CDD:409377"
     misc_feature    834..875
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409377"
     misc_feature    891..1148
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    933..947
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409579"
     misc_feature    984..998
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409579"
     misc_feature    1041..1055
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409579"
     misc_feature    1083..1100
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409579"
     misc_feature    1128..1139
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409579"
     misc_feature    1224..1460
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    1257..1271
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1296..1310
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1362..1376
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1395..1412
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1440..1451
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     exon            496..876
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     exon            877..1155
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     exon            1156..1203
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     exon            1204..1473
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     exon            1474..1570
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     exon            1571..1667
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
     exon            1668..2270
                     /gene="SIGLEC12"
                     /gene_synonym="S2V; Siglec-XII; SIGLECL1; SLG"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agttcctgagagaagaaccctgaggaacagacttacctcagcaaccctggcacctccaacccgacacatgctactgctgctgctactgctgccacccctgctctgtgggagagtgggggctaaggaacagaaggattacctgctgacaatgcagaagtccgtgacggtgcaggagggcctgtgtgtctctgtgctttgctccttctcctacccccaaaatggctggactgcctccgatccagttcatggctactggttcaggggcaggggaccatgtaagccggaacattccagtggccacaaacaacccagttcgagcagtgcaggaggagactcgggaccgattccacctccttggggacccacagaacaaggattgtaccctgagcatcagagacaccagagagagtgatgcagggacatacgtcttttgtgtagagagaggaaatatgaaatggaattataaatatgaccagctctctgtgaatgtgacagcgtcccaggacctactgtcaagatacaggctggaggtgccagagtcggtgactgtgcaggagggtctgtgtgtctctgtgccctgcagtgtcctttacccccattacaactggactgcctctagccctgtttatggatcctggttcaaggaaggggccgatataccatgggatattccagtggccacaaacaccccaagtggaaaagtgcaagaggatacccagggtcgattcctcctccttggggacccacagaccaacaactgctccctgagcatcagagatgccaggaagggggattcagggaagtactacttccaggtggagagaggaagcaggaaatggaactacatatatgacaagctctctgtgcatgtgacagccctgactcacatgcccaccttctccatcccggggaccctggagtctggccaccccaggaacctgacctgctctgtgccctgggcctgtgaacaggggacgccccccacgatcacctggatgggggcctccgtgtcctccctggaccccactatcactcgctcctcgatgctcagcctcatcccacagccccaggaccatggcaccagcctcacctgtcaggtgaccttgcctggggccggtgtgaccatgaccagggctgtccgactcaacatatcctatcctcctcagaacttgaccatgactgtcttccaaggagatggcacagcatccacaaccttgaggaatggctcggccctttcagtcctggagggccagtccctgtaccttgtctgtgctgtcgacagcaatccccctgccaggctgagctggacctgggggagcctgaccctgagcccctcacagtcctcgaaccttggggtgctggagctgcctcgagtgcatgtgaaggatgaaggggaattcacctgccgagctcagaaccctctaggctcccagcacatttccctgagcctctccctgcaaaacgagtacacaggcaaaatgaggcctatatcaggagtgatgctaggggcattcgggggagctggagccacagccctggtcttcctgtccttctgcatcatcttcgttgtagtgaggtcctgcaggaagaaatcggcaaggccagcagtgggcgtgggggatacaggcatggaggacgcaaacgctgtcaggggctcagcctctcagggacccctgattgaatccccggcagatgacagccccccacaccatgctccgccagccctggccaccccctccccagaggaaggagagatccagtatgcatccctcagcttccacaaagcgaggcctcagtacccacaggaacaggaggccatcggctatgagtactccgagatcaacatccccaagtgagaaactgcagagactcaggcctgtttgagggctcacgacccctgcagcaaagaagcccgagactgattcctttagaattaacagccctccatgctgtgcaacaggacatcagaacttattcctcttgtcaaactgaaaatgcgtgcctgatgaccaaactctccctttctccatccaatcggtccacactccccgcccccggcctctggtacccaccattctcttctctacttctctgaggtcgactattttaggttccaaatatagtgagatcgtagagtgtttgtctctctgtacctggcttatttcactcaacataatgttctctaggttcatccgtgttgttccaaataacagaataatgtattgaatatttcaaaatggctaaaagagaggagtttaaatgttgtcacc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]