GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:26:11, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_001405494            2516 bp    mRNA    linear   PRI 07-AUG-2024
DEFINITION  Homo sapiens proline rich transmembrane protein 4 (PRRT4),
            transcript variant 6, mRNA.
ACCESSION   NM_001405494 XM_047420370
VERSION     NM_001405494.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2516)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   2  (bases 1 to 2516)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am J Hum Genet 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC010655.7.
            
            On Apr 25, 2022 this sequence version replaced XM_047420370.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14038192.3376125.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2163105 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-130               AC010655.7         31310-31439         c
            131-247             AC010655.7         31055-31171         c
            248-971             AC010655.7         29089-29812         c
            972-1076            AC010655.7         28898-29002         c
            1077-1196           AC010655.7         28430-28549         c
            1197-1426           AC010655.7         22198-22427         c
            1427-2516           AC010655.7         20074-21163         c
FEATURES             Location/Qualifiers
     source          1..2516
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q32.1"
     gene            1..2516
                     /gene="PRRT4"
                     /note="proline rich transmembrane protein 4"
                     /db_xref="GeneID:401399"
                     /db_xref="HGNC:HGNC:37280"
     exon            1..130
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            131..247
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            248..971
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    278..280
                     /gene="PRRT4"
                     /note="upstream in-frame stop codon"
     CDS             320..1609
                     /gene="PRRT4"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 6"
                     /codon_start=1
                     /product="proline-rich transmembrane protein 4 isoform 2
                     precursor"
                     /protein_id="NP_001392423.1"
                     /db_xref="CCDS:CCDS47698.2"
                     /db_xref="GeneID:401399"
                     /db_xref="HGNC:HGNC:37280"
                     /translation="
MARHGCLGLGLFCCVLFAATVGPQPTPSIPGAPATTLTPVPQSEASMLSLNLGLNFKFHLRGPAAVWGSPVTETQPLSLGPGQEPGEEVASGLRTDPLWELLVGSSGNSLTEWGSTEGGSKPRASSLLPESTSRRSGPSDGPTAPYQPRRSTVTWDTALMVTALPSSAPRPHQSELELKFDMALRAGAAPTLGHRTLPLLPSLRASLAEIAGRLGPFGFFGTTLSPLRNFSGLSPPGETTSTSSASGVSGSLGFLGTTLSLPPYSLERKLSSPSPLDPAASLSFASIATTSLDPTVPISGPDDLSPPASLGNPSGQPECGPGSCSVGELPEREGQPPEAPRPLFFLTLEADWAEARARWGLAWEAHVYGRLHRGLPPALPNQPATQHRGGPLQRGPACAWPLPGPCLRGRSAWARTLPHRLAGDRGQGQ"
     sig_peptide     320..388
                     /gene="PRRT4"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    647..775
                     /gene="PRRT4"
                     /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1202..1339
                     /gene="PRRT4"
                     /note="propagated from UniProtKB/Swiss-Prot (C9JH25.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            972..1076
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            1077..1196
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            1197..1426
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     exon            1427..2516
                     /gene="PRRT4"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2497..2502
                     /regulatory_class="polyA_signal_sequence"
                     /gene="PRRT4"
                     /note="hexamer: AATAAA"
     polyA_site      2516
                     /gene="PRRT4"
                     /note="major polyA site"
ORIGIN      
agagccggctgccgcggagccccggcgcgggcggcttcgccggggagcgaggctcggagccaggaggcggcgccgctgggagggagcgcggagtgcggagtgcggagcgcggggcctggccgcccgcctgagagaagcggtgagataccacgaagcgttgcccagctgggcgccagggccgccacgaccgccccttttcggaggctcggcgaggagacctgcctgcgggagagaccccggggagcaggaccttcctcctcaaaagctgctgaacaactgagtccctgcccaccaaggccacccgaagccaggtggggccatggccaggcatggctgtctagggctgggactgttctgctgcgtcctgtttgctgctactgtgggcccccagcccaccccctccatcccaggtgcccctgccaccactttgacccccgtacctcaaagtgaggcctctatgctgtctctcaacctgggacttaacttcaaattccatcttcggggacctgctgctgtctgggggagcccagtcacagagacccagccactctctcttgggccaggccaggagccaggggaagaggtggccagtgggctgaggactgaccccctttgggaattgctggtgggctcctcagggaactctctcactgagtggggctccaccgaaggtggctcaaagccccgggcctcctccctgcttccggagtccacatcccggcgctctgggcccagcgatgggcccactgccccctatcagcccaggaggagcactgtgacctgggacactgctctgatggtgacagcacttccatccagtgctcccaggccccaccagagcgagctggagctgaagtttgacatggcactgagagcaggtgcagcccccacgcttgggcatcgaacgctgcccctgctgcccagcctgcgggccagcctggcagagattgctgggcgcctgggaccctttggattctttggcactactctgtccccactccggaacttctccggcctgagccccccaggtgaaactacatccacaagctctgcctctggagtttcgggttctctggggttccttggtaccactctgtccctgcccccatactccctggagaggaagctctccagcccaagtcctctggacccagctgcttccctaagttttgcctcgattgcaacaacatcattagaccccacagtccccatctctggcccagatgacctctctcctcccgccagcctcgggaacccttcggggcagccagagtgtgggccagggtcctgcagcgtgggagaattgcctgaacgcgaggggcagcctcccgaggcgccgaggcccctctttttcctgaccctggaggccgactgggcagaggccagggctcgctgggggctggcctgggaggcccacgtgtacgggcgattacaccgtggacttccgcccgccctccccaatcaacctgcgacgcagcatcgaggaggccctctgcagcgaggccctgcttgcgcctggcctcttccagggccctgccttcgaggacgctctgcctgggctcggactctaccgcaccgcctcgctggggaccgggggcagggccagtgagagatcaggggaggcctctggccccgctgcgcccccggagctcccctcccctggggcttggcccgcaggcagcagcgtctcatctggctcgttctgcggactctcgcgggacagctcgtccatgctgctgtgttccagccccgacaggcccccgcgctgccctctggtctgcgtcctcagtcccccgcggccctcaggaagcagccccagcctcccggcctcaggatcctaccaggccctgtccccaccctctcgcgactccccagagcctgcttctgagctgcaggccgaggaggccttgctgcaggagcagttcctggacgcctgccgacagatcgacgagctgagcgtgggcagcgacaccatagacctgtgaagaggtggccaccttgctaccctgcgatatgcccctttctggcgcctgccctgcccgagacctgcacactgtaatccttccccaatcctccctggctcagatacctctccagattccttccccatccaggggtccctgggtgggtgggtcagcagccaggctctatcgattgggaatcagtgccaccttctctggagccctgggtgctgatgccctcagctgcaaatctaggttggcaggggtcccattttccttggcattcaccagcaataaagctccaaggtgctccactcctgaccaccactccccactctggtgctgagtgagaggggctgtcctcagaggaccctgggacctgcctcaggcccccctacccacctctgccatgcctaggaatcccacccctgtgtgaatgggactccctttcctccatgtgacacccacaggggtccatgacccatctaggagactttatagcagttgggtgggaggggaatgctcttaatttatcaataaaatattttcagagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]