2025-04-04 14:32:51, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS NM_001182488 939 bp mRNA linear PLN 17-DEC-2024 DEFINITION Saccharomyces cerevisiae S288C cytochrome-b5 reductase (PGA3), partial mRNA. ACCESSION NM_001182488 VERSION NM_001182488.1 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 939) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 939) AUTHORS Bowman,S., Churcher,C., Badcock,K., Brown,D., Chillingworth,T., Connor,R., Dedman,K., Devlin,K., Gentles,S., Hamlin,N., Hunt,S., Jagels,K., Lye,G., Moule,S., Odell,C., Pearson,D., Rajandream,M., Rice,P., Skelton,J., Walsh,S., Whitehead,S. and Barrell,B. TITLE The nucleotide sequence of Saccharomyces cerevisiae chromosome XIII JOURNAL Nature 387 (6632 SUPPL), 90-93 (1997) PUBMED 9169872 REFERENCE 3 (bases 1 to 939) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 4 (bases 1 to 939) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (17-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 939) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (04-MAY-2012) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 6 (bases 1 to 939) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Sequence update by submitter REFERENCE 7 (bases 1 to 939) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (14-DEC-2009) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001145). ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-4-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..939 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="XIII" gene <1..>939 /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /db_xref="GeneID:854914" CDS 1..939 /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /EC_number="1.6.2.2" /experiment="EXISTENCE:direct assay:GO:0005783 endoplasmic reticulum [PMID:26928762|PMID:14562095]" /experiment="EXISTENCE:direct assay:GO:0005886 plasma membrane [PMID:19239415]" /experiment="EXISTENCE:mutant phenotype:GO:0004128 cytochrome-b5 reductase activity, acting on NAD(P)H [PMID:19239415]" /experiment="EXISTENCE:mutant phenotype:GO:0015031 protein transport [PMID:16943325]" /note="Putative cytochrome b5 reductase, localized to the plasma membrane; may be involved in regulation of lifespan; required for maturation of Gas1p and Pho8p, proposed to be involved in protein trafficking; PGA3 has a paralog, AIM33, that arose from the whole genome duplication" /codon_start=1 /product="cytochrome-b5 reductase" /protein_id="NP_013581.1" /db_xref="GeneID:854914" /db_xref="SGD:S000004594" /translation="
MSKEDIEGTNILDEPVHGIYIPAALFVVGVAITTYMSGELKILWSLPILFMIIFVRAYSAYKRRRSLYPDRWTSLELEDQTIISKNTALYRFKLKTRLESLDIPAGHHVAVRVPIDGKQEVRYYNPISSKLESGYLDLVVKAYVDGKVSKYFAGLNSGDTVDFKGPIGTLNYEPNSSKHLGIVAGGSGITPVLQILNEIITVPEDLTKVSLLYANETENDILLKDELDEMAEKYPHFQVHYVVHYPSDRWTGDVGYITKDQMNRYLPEYSEDNRLLICGPDGMNNLALQYAKELGWKVNSTRSSGDDQVFVF"
misc_feature 223..936 /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /note="Cytochrome b5 reductase catalyzes the reduction of 2 molecules of cytochrome b5 using NADH as an electron donor. Like ferredoxin reductases, these proteins have an N-terminal FAD binding subdomain and a C-terminal NADH binding subdomain, separated by a...; Region: cyt_b5_reduct_like; cd06183" /db_xref="CDD:99780" misc_feature order(322..324,364..375,415..423,427..429,433..447, 559..561,568..573,934..936) /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /note="FAD binding pocket [chemical binding]; other site" /db_xref="CDD:99780" misc_feature order(364..366,370..375) /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /note="FAD binding motif [chemical binding]; other site" /db_xref="CDD:99780" misc_feature order(421..423,427..429,559..564,640..648,730..732, 766..768,835..849) /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /note="NAD binding pocket [chemical binding]; other site" /db_xref="CDD:99780" misc_feature order(436..438,445..447,454..456,472..474,496..498, 502..504) /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /note="phosphate binding motif [ion binding]; other site" /db_xref="CDD:99780" misc_feature order(544..546,556..567,571..573) /gene="PGA3" /locus_tag="YML125C" /gene_synonym="NQR1" /note="beta-alpha-beta structure motif; other site" /db_xref="CDD:99780" ORIGIN
atgtcaaaagaagacatagaaggaactaacattctagacgaacctgtccacgggatctatattcctgccgcgctattcgttgttggtgttgcaatcaccacgtatatgtctggtgaattgaaaatcctgtggagtttacccattctcttcatgatcatcttcgtcagagcatactctgcctacaaaagaagaagatcactgtatccagataggtggacttcgttagaattggaagatcaaaccataatttccaagaataccgccctgtatcgttttaagttgaagacaagactggaaagcttggacattcccgctggtcatcatgttgctgtacgcgttccaattgacggcaaacaagaggtcagatactataatccgatcagttctaaactagaaagtggatacttggatttggtggtgaaagcatacgttgatggtaaagtctccaaatatttcgctggcttaaattctggtgacaccgtggatttcaaggggccaataggtactttgaactacgaaccaaattcctccaagcatttaggtatcgtagccggtggttctggtatcacgccagtcctacagatcttgaatgaaatcatcaccgttcctgaagatttgacgaaagtctccctgctatatgccaatgagactgaaaatgacattctattgaaggacgaactggatgagatggccgaaaaatacccacatttccaggtccattacgtggtacactatccatccgacagatggaccggagatgtcggctacatcaccaaggaccagatgaacaggtatctgccggaatattcggaggataacagactcttgatctgtggacctgatggaatgaacaacttggcccttcaatacgctaaagaactgggctggaaggtcaattcaacgagaagttctggcgacgatcaagtcttcgtcttttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]