2025-10-17 07:46:28, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001180916 705 bp mRNA linear PLN 30-JUN-2025 DEFINITION Saccharomyces cerevisiae S288C DUP240 family protein MST27 (MST27), partial mRNA. ACCESSION NM_001180916 VERSION NM_001180916.1 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 705) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 705) AUTHORS Tettelin,H., Agostoni Carbone,M.L., Albermann,K., Albers,M., Arroyo,J., Backes,U., Barreiros,T., Bertani,I., Bjourson,A.J., Bruckner,M., Bruschi,C.V., Carignani,G., Castagnoli,L., Cerdan,E., Clemente,M.L., Coblenz,A., Coglievina,M., Coissac,E., Defoor,E., Del Bino,S., Delius,H., Delneri,D., de Wergifosse,P., Dujon,B., Kleine,K. et al. TITLE The nucleotide sequence of Saccharomyces cerevisiae chromosome VII JOURNAL Nature 387 (6632 SUPPL), 81-84 (1997) PUBMED 9169869 REFERENCE 3 (bases 1 to 705) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 4 (bases 1 to 705) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (30-JUN-2025) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 705) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (16-JAN-2015) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 6 (bases 1 to 705) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (04-MAY-2012) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 7 (bases 1 to 705) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Sequence update by submitter REFERENCE 8 (bases 1 to 705) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (11-DEC-2009) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001139). ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-4-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..705 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="VII" gene <1..>705 /gene="MST27" /locus_tag="YGL051W" /db_xref="GeneID:852830" CDS 1..705 /gene="MST27" /locus_tag="YGL051W" /experiment="EXISTENCE:direct assay:GO:0005783 endoplasmic reticulum [PMID:12925749|PMID:26928762]" /experiment="EXISTENCE:direct assay:GO:0005794 Golgi apparatus [PMID:12925749]" /experiment="EXISTENCE:direct assay:GO:0016020 membrane [PMID:12925749]" /experiment="EXISTENCE:genetic interaction:GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport [PMID:12925749]" /experiment="EXISTENCE:genetic interaction:GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum [PMID:12925749]" /experiment="EXISTENCE:mutant phenotype:GO:0005783 endoplasmic reticulum [PMID:12101299]" /experiment="EXISTENCE:mutant phenotype:GO:0005886 plasma membrane [PMID:12101299]" /note="Putative integral membrane protein, involved in vesicle formation; forms complex with Mst28p; member of DUP240 gene family; binds COPI and COPII vesicles; MST27 has a paralog, MST28, that arose from a segmental duplication" /codon_start=1 /product="DUP240 family protein MST27" /protein_id="NP_011464.1" /db_xref="GeneID:852830" /db_xref="SGD:S000003019" /translation="
MQTPLESTDVKLDTLNEPSAHLIEKNVALPKDIFRSYLSYWIYEIARYTPVMILSLVIGVLVLLIIFFNDNEACVFNSAYYAYLSLVVLLIILGDGNPKLVSRRNFRTELLVDVITRKPAVEGKEWRIITYNMNQYLFNHGQWHTPYYFYSDEDCYRYFLRLVEGVTPKKQTATSIGNSPVTAKPEDAIESASPSSRLNYRNFLLKAAEIERQAQENYWRRRHPNIDALLKKTE"
misc_feature <286..513 /gene="MST27" /locus_tag="YGL051W" /note="DUP family; Region: DUP; pfam00674" /db_xref="CDD:395546" ORIGIN
atgcagacccctctagaaagtaccgacgtcaagttagatacactcaacgaacctagtgcacatttaattgagaaaaatgtggctcttcctaaggacatattccgttcgtacttgagttattggatctatgaaatcgctcgctatacaccagtcatgattttgtccctggtaataggggttttggttttattaattatattttttaatgacaacgaagcttgtgttttcaattctgcatactacgcttatctttctcttgtagtattgttaataatattaggtgatggtaatccaaagctagtcagtcgtcgaaattttaggaccgagcttttagtggatgtcatcacacgtaaaccggcagtagaagggaaagaatggaggatcatcacatacaacatgaaccaatatttgtttaatcatgggcaatggcatactccgtattacttttacagcgatgaggattgctaccgttattttctacgccttgttgagggagtaacccccaagaagcaaacagccacgtcaattggcaattctccggtcaccgctaagcctgaagatgccatcgagtcagcttctcctagttccagactgaattatcgaaactttttgctcaaggcagcggagatcgaacgacaagctcaggaaaattactggcgaaggcggcatcccaatatcgatgcgcttcttaaaaagacggaatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]