2025-06-08 06:15:02, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001178224 897 bp mRNA linear PLN 17-DEC-2024 DEFINITION Saccharomyces cerevisiae S288C pheromone-regulated DUP240 family protein PRM9 (PRM9), partial mRNA. ACCESSION NM_001178224 VERSION NM_001178224.1 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 897) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 897) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 3 (bases 1 to 897) AUTHORS Bussey,H., Kaback,D.B., Zhong,W., Vo,D.T., Clark,M.W., Fortin,N., Hall,J., Ouellette,B.F., Keng,T., Barton,A.B. et al. TITLE The nucleotide sequence of chromosome I from Saccharomyces cerevisiae JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (9), 3809-3813 (1995) PUBMED 7731988 REFERENCE 4 (bases 1 to 897) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (17-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 897) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Sequence update by submitter REFERENCE 6 (bases 1 to 897) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (11-DEC-2009) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001133). ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-5-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..897 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="I" gene <1..>897 /gene="PRM9" /locus_tag="YAR031W" /db_xref="GeneID:851282" CDS 1..897 /gene="PRM9" /locus_tag="YAR031W" /experiment="EXISTENCE:direct assay:GO:0005783 endoplasmic reticulum [PMID:26928762]" /experiment="EXISTENCE:direct assay:GO:0005886 plasma membrane [PMID:12101299]" /experiment="EXISTENCE:physical interaction:GO:0005783 endoplasmic reticulum [PMID:12925749]" /note="Pheromone-regulated protein; contains 3 predicted transmembrane segments and an FF sequence, a motif involved in COPII binding; member of DUP240 gene family; PRM9 has a paralog, PRM8, that arose from a segmental duplication" /codon_start=1 /product="pheromone-regulated DUP240 family protein PRM9" /protein_id="NP_009418.1" /db_xref="GeneID:851282" /db_xref="SGD:S000000078" /translation="
MSPQYHFYFVSFRNLVLNEKCLRSKKQVMKSFNWYKTDRYFDPHNILQHHSRAIEKTRYKLGMQTSSESTDAKSDFLDEPSAYLIEKNVALPKDIFGSYLSYWIYEVTRHKAAVILLVLIVTSILLLVFFYNTEFCVAFEILLFSFCFPGTCMVVIAFSEPIGDREFKVKLLMEIITRKPAVKGKEWRTITYKMNQYLFDHGLWDTPYYFYRDEDCHRYFLSLIKGRTFKKQKESSASNVKDAQSNDETAGTPNEAAESSSFSAGPNFIKLLTKAAEIEQQFQKEYWRQEYPGVDEFF"
misc_feature 427..696 /gene="PRM9" /locus_tag="YAR031W" /note="DUP family; Region: DUP; pfam00674" /db_xref="CDD:395546" ORIGIN
atgtcgcctcaataccatttttattttgtatcattccggaacttagtattgaatgaaaaatgcctccgaagtaaaaagcaggtgatgaaaagtttcaattggtataagacagatcgctattttgatccgcataacatccttcaacaccatagcagagctatagagaagacaagatataaactgggcatgcaaacatcttcagaaagtaccgacgccaagtcggattttctcgacgaacccagtgcatatttaattgagaaaaatgtggctcttcccaaggacatattcggttcgtacttaagttattggatatatgaagttactcgtcataaagcggcagtaattttgctcgtacttattgtgacttcaattttattattagtgtttttttataatacggaattttgcgttgcctttgagatactattgttttccttttgctttccaggaacatgcatggttgtaattgcatttagtgaaccgatcggtgatcgggaatttaaagttaagcttctgatggaaattatcacacgtaaaccggcggtaaaggggaaagaatggaggacaattacatacaagatgaaccagtatttatttgatcatgggctatgggatactccctactacttttaccgtgatgaagattgccaccgttattttctaagtcttattaagggaagaactttcaagaagcaaaaggaatcgtcagccagcaatgttaaagacgcacaatcaaatgacgaaaccgctggcacaccaaacgaagccgctgagtcttctagttttagtgccggaccgaactttataaagctcctcaccaaggcagccgaaatcgaacaacaatttcaaaaggaatattggcgacaagagtatcctggtgtcgatgagtttttttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]