ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-10 23:20:02, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001129918 5682 bp mRNA linear VRT 02-APR-2025 DEFINITION Xenopus tropicalis dicer 1, ribonuclease III (dicer1), mRNA. ACCESSION NM_001129918 VERSION NM_001129918.2 KEYWORDS RefSeq. SOURCE Xenopus tropicalis (tropical clawed frog) ORGANISM Xenopus tropicalis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Silurana. REFERENCE 1 (bases 1 to 5682) AUTHORS Klein,S.L., Strausberg,R.L., Wagner,L., Pontius,J., Clifton,S.W. and Richardson,P. TITLE Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative JOURNAL Dev Dyn 225 (4), 384-391 (2002) PUBMED 12454917 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from EU338242.1. On Jul 18, 2009 this sequence version replaced NM_001129918.1. ##Evidence-Data-START## Transcript exon combination :: EU338242.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMD00028290, SAMD00028291 [ECO:0000350] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..5682 /organism="Xenopus tropicalis" /mol_type="mRNA" /db_xref="taxon:8364" /chromosome="8" /map="8" gene 1..5682 /gene="dicer1" /gene_synonym="dcr1; dicer; herna" /note="dicer 1, ribonuclease III" /db_xref="GeneID:100170154" /db_xref="Xenbase:XB-GENE-491114" CDS 1..5682 /gene="dicer1" /gene_synonym="dcr1; dicer; herna" /EC_number="3.1.26.3" /note="dicer 1, ribonuclease type III" /codon_start=1 /product="endoribonuclease Dicer" /protein_id="NP_001123390.2" /db_xref="GeneID:100170154" /db_xref="Xenbase:XB-GENE-491114" /translation="
MAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNSGSGKTFIAVLLSKELSYQIRGDFSKNTKRTVFLVNSEKQVSQQVSAVRTHTDLKVGEYSDQEKTQCWAKERWYLEFETHQVLVMTCHIFLNVLKSGNVSLSNINLLVFDECHLAIQDHPYREIMKICESCQPCPRILGLTASILNGKCDPRDLEEKIQKLEEILRSNAETATDLVVLDRYASQPCEIVLDCGPYIDKSGLYQRLLNELDEALNFLIDCNISTHSKERDSTLISKQILSDCQTVLLVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTILRKIHALCEEHFSPASLDMKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDDEDEEIEEKEKTETSFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEVEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPSEYRSYVQSKGRARAPISNYIMLADSDKIKAFEEDLKTYKAIEKILRNKCSKSIDCGNTESEPIVDDDEIFPPYVLRQDDGSPRVTINTAIGHINRYCARLPSDPFTHLAPKCKTREFPDGLYRSTLYLPINSPLRAPIVGPPMNCGRLADRAVALICCKKLHEIGELDDHLMPVGKETVKYEEELDLHDEEETSVPGRPGSTKRRQCYPKAIPECLRNSYPKPGQPCYLYVIGMVLTTPLPDELNFRRRKLYPPEDTTRCFGILTAKPIPQIPHFPVYTRSGEVTISIELKKSGFTLNLEQLELITRLHQYIFSHILRLEKPALEFKPTVADCAYCVLPLNVVNDSGTLDIDFKFVEDIEKSEARTGIPNTQYSAESPFIFKLEDYQDAVIIPRQVIYRNFDQPHRFYVADVYTDLTPLSKFPSPEYETFAEYYKTKYNLDLTNLNQPLLDVDHTSSRLNLLTPRHLNQKGKALPLSSAEKRKAKWESLQNKQILVPELCAIHPVPASLWRKAVCLPSILYRLHCLLTAEELRAQTAIDAGVGVKSLPDDFRYPNLDFGWKRSIDSKTFISNQSSSSVESESDCRLNKTTAPDSAASSAANSVIYMQINDQMSVNCTPPCQKSLSHLQTVCFSDDYKAINGISCNGLTNGDWEAESAACFQKDERITCKQEIPEKSTSFHVQNLPKENQPILKECTLSNSDGNVSKPTSDECPSTCTSDMHYDSGLSNRHSSKTLGPNPGLILQALTLSNASDGFNLERLEMLGDSFLKHAITTYLFCTYPDAHEGRLSYMRSKKVSNCNLYRLGKKKGSPSRMVVSIFDPPVNWLPPGYIVNQDKNSDKWESNETSGEDVMVNGKIDEDFDDEEDEDLMWRNPKEETDFDDDFLEYDQEHIKFIDSMLMGSGAFVKKIPLSSFAPPDQNYEWRAPKKPPLESSQFPCDFDDFDYSSWDAMCYLDPSKAVEEDDFVVGFWNPSEENCGADAGKQSISYDLHTEQCIADKSIADCVEALLGCYLTSCGERAAQLFLCSLGLKVLPEVRKLVTNTNVISASSSYQNSTRDNCTLTARTNTDLSSCKGIDYGYLKIPPRCMFEHPDAEKTLDHLISGFENFEKKINYPFKNKAYLLQAFTHASYHYNTITDCYQRLEFLGDAILDYLITKHLYEDPRQHSPGVLTDLRSALVNNTIFASLAVKYDYHKYFKAISPELFHVIDDFVQFQLEKNEMQGMDSELRRSEEDEEKEEDIEVPKAMGDIFESLAGAIYMDSGMSLETVWHVYYPMMQPLIEKFSANVPRSPVRELLEMEPETAKFSPAERTYDGKVRVTVEVVGKGKFKGVGRSYRIAKSAAARRALRSLKANQSQVPNS"
misc_feature 94..687
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="DEXH-box helicase domain of endoribonuclease Dicer;
Region: DEXHc_dicer; cd18034"
/db_xref="CDD:350792"
misc_feature order(94..105,112..114,163..186,307..309,496..498,
589..591)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:350792"
misc_feature order(271..276,343..348,421..423,427..432,439..441,
514..522)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="nucleic acid binding site [nucleotide binding];
other site"
/db_xref="CDD:350792"
misc_feature 493..504
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="propagated from UniProtKB/Swiss-Prot (B3DLA6.2);
Region: DECH box"
misc_feature 781..1065
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="Partner-binding domain of the endoribonuclease
Dicer; Region: Dicer_PBD; cd15903"
/db_xref="CDD:277191"
misc_feature order(796..801,808..810,814..819,994..999,1006..1011,
1018..1020,1027..1032,1039..1041)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="Trbp binding interface [polypeptide binding]; other
site"
/db_xref="CDD:277191"
misc_feature 1078..1665
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="C-terminal helicase domain of the endoribonuclease
Dicer; Region: SF2_C_dicer; cd18802"
/db_xref="CDD:350189"
misc_feature 1198..1272
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="propagated from UniProtKB/Swiss-Prot (B3DLA6.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature order(1318..1326,1534..1536,1591..1593,1597..1599)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:350189"
misc_feature order(1546..1548,1552..1554,1627..1629,1633..1635)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:350189"
misc_feature 1861..2127
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="Dicer dimerization domain; Region: Dicer_dimer;
pfam03368"
/db_xref="CDD:460900"
misc_feature 2152..2211
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="propagated from UniProtKB/Swiss-Prot (B3DLA6.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 2629..3006
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="PAZ domain, dicer_like subfamily. Dicer is an RNAse
involved in cleaving dsRNA in the RNA interference
pathway. It generates dsRNAs which are approximately 20 bp
long (siRNAs), which in turn target hydrolysis of
homologous RNAs. PAZ domains are named...; Region:
PAZ_dicer_like; cd02843"
/db_xref="CDD:239209"
misc_feature order(2827..2829,2866..2868,2884..2886,2896..2898,
2950..2952,2974..2976,2980..2982)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239209"
misc_feature 3817..>4092
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="Ribonuclease III family; Region: RIBOc; smart00535"
/db_xref="CDD:197778"
misc_feature order(3868..3873,3880..3885,3892..3894,3901..3906,
3913..3918,3922..3930,3958..3960)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="dimerization interface [polypeptide binding]; other
site"
/db_xref="CDD:238333"
misc_feature 4957..5451
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="Ribonuclease III C terminal domain. This group
consists of eukaryotic, bacterial and archeal ribonuclease
III (RNAse III) proteins. RNAse III is a double stranded
RNA-specific endonuclease. Prokaryotic RNAse III is
important in post-transcriptional...; Region: RIBOc;
cd00593"
/db_xref="CDD:238333"
misc_feature order(5017..5022,5029..5034,5041..5043,5050..5055,
5062..5067,5071..5079,5107..5109,5371..5373,5404..5406)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="dimerization interface [polypeptide binding]; other
site"
/db_xref="CDD:238333"
misc_feature order(5017..5019,5026..5028,5038..5040,5341..5343,
5350..5352)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="active site"
/db_xref="CDD:238333"
misc_feature order(5026..5028,5341..5343,5350..5352)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="metal binding site [ion binding]; metal-binding
site"
/db_xref="CDD:238333"
misc_feature 5329..5331
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="Important for activity. /evidence=ECO:0000250;
propagated from UniProtKB/Swiss-Prot (B3DLA6.2); other
site"
misc_feature 5464..5652
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="double-stranded RNA binding motif of
endoribonuclease Dicer and similar proteins; Region:
DSRM_DICER; cd10843"
/db_xref="CDD:380680"
misc_feature order(5464..5469,5473..5478,5485..5490,5497..5502,
5512..5514,5527..5535,5539..5541,5545..5547,5596..5607,
5614..5616)
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/note="putative RNA binding site [nucleotide binding];
other site"
/db_xref="CDD:380680"
exon 1..114
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 115..277
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 278..408
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 409..543
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 544..704
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 705..873
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 874..1349
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 1350..1482
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 1483..1725
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 1726..1880
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 1881..2013
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2014..2089
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2090..2229
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2230..2409
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2410..2623
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2624..2786
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2787..2969
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 2970..3075
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 3076..3251
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 3252..3981
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 3982..4134
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 4135..5008
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 5009..5277
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 5278..5440
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 5441..5516
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
exon 5517..5682
/gene="dicer1"
/gene_synonym="dcr1; dicer; herna"
/inference="alignment:Splign:2.1.0"
ORIGIN
atggcaggccttcagctcatgactccggcctcctctccaatgggtcccttctttgggctaccctggcaacaggaggctattcatgacaacatttataccccacggaaatatcaggtggaactactcgaagcagcattggatcataatactatagtatgtttgaattctggctcagggaagacatttattgcagtactactcagtaaagagctgtcataccagatccgtggggacttcagcaaaaatactaagaggactgtgtttttggtcaattccgagaaacaggtttctcaacaagtgtctgctgtcaggacccatacagacctcaaggtgggagaatattcagatcaagaaaaaacacaatgctgggcaaaagaaagatggtacctagaatttgaaactcatcaggtcttggtcatgacctgccacatcttcctgaacgttctgaaaagtgggaacgtgtcattgtcaaacattaatctgttagtgtttgatgaatgtcatcttgcaattcaggatcacccatatcgagaaatcatgaagatatgtgagagttgccagccatgccctcgaatcctgggtctaactgcttcaattttaaatggaaaatgtgaccctcgtgacctagaggaaaagatccagaaactggaggaaatattaaggagtaatgcagaaactgcaactgatttggttgttttagacaggtatgcttcccaaccatgtgaaattgtattggactgtgggccatatattgacaaaagtggactttatcaaagacttctaaatgaattggatgaagcccttaactttctcattgactgtaatatttctacacattctaaagagagagattccacattaatttcaaaacagattctatcagactgtcaaactgttcttttggtcttgggaccatggtgtgctgataaagttgcggggatgatggtgagagagctgcagaagtatatcaaacatgagcaggaggaactgcacagaaaattccttttgtttacagacactatcttaaggaagatccatgctctttgtgaggaacacttctcgccagcctctcttgatatgaagtttgtcacacctaaagttataaaactgctggaaattttacgcaaatacaaaccctacgaacgccagcaatttgaaagtgttgaatggtataacaatagaaaccaggataattatgtgtcttggagtgattcagaggatgatgacgatgaagatgaagaaattgaggagaaagagaaaactgaaacaagctttccatccccattcacaaacatcctgtgtggcatcatcttcgtggaacgaagatacacagcagtagtattaaacaggttgattaaagaagccgggaagcaagatccagagctggcctatatcagtagtaactttattactgggcacggcataggaaagaaccagccacgcaataagcagatggaagttgagtttagaaagcaagaagaggtgcttcgtaaatttcgtgcacacgaaaccaacttattgatagctactagcattgttgaggaaggagtggacataccaaaatgcaacttggtagttcgatttgatttaccttcagagtacagatcctatgtacagtccaaaggcagagcaagagcaccaatctcaaattacatcatgctagccgatagtgataaaattaaggcatttgaagaggaccttaaaacatacaaagcaattgaaaagattctgcggaacaaatgctcaaagtccattgattgtggaaatacagaatctgagcccattgtggacgatgatgaaatatttccaccatatgtgttgagacaggatgatggcagcccacgagttactatcaacaccgctattggacacattaacaggtactgtgctaggctacctagtgacccatttactcatcttgctcctaagtgcaaaacacgagagttccctgatggactttatcgctcaacactctacctgccaattaattctccacttagagcccccattgttggccctccgatgaattgtggaaggctagctgatagagctgtagctcttatatgctgtaaaaaactacatgaaattggtgaactggatgatcatttaatgccagttggcaaggaaactgtaaaatatgaggaggagcttgatttgcatgatgaggaagaaaccagtgttccaggcagaccaggatccacaaaaagaaggcagtgttatccaaaagctattcctgaatgtttacggaacagctaccccaagcctggtcagccttgttacttatatgtaataggaatggtattaaccactcctctaccagatgaacttaattttaggcgacggaagctgtatccccctgaagacacaacaagatgctttggaatactaactgccaaacccatacctcagattcctcactttcctgtctatactcgttcgggagaggtgaccatatcaattgaactaaagaagtctggttttacattaaacttagaacaacttgagctcattactagactccaccagtacattttttcacacattcttcgtcttgagaaacctgcactagaatttaaacccacagtagccgattgtgcctactgtgttctacctcttaacgttgtaaatgattctggcactttggacattgacttcaaatttgtagaagatattgagaaatcagaagcacgtactggtatacctaatacacagtattcagctgaaagtccttttattttcaaattagaagactaccaggatgctgttatcattccaaggcaagtaatatatcgaaattttgatcagccgcacagattttatgtagctgatgtatacactgatcttacaccgctcagcaagttcccttcccctgaatatgaaacctttgctgaatattacaaaacaaagtataacctcgatctcacaaacctcaatcagccacttttggatgtggaccacacatcatcaagacttaatttgctgactcctcgccatctgaatcagaaaggtaaagctctgccattaagcagtgctgaaaagagaaaagccaaatgggagagtttacaaaacaaacagatcctggttccagagctttgtgctatacatccagtcccagcatccttatggagaaaagctgtttgtttgccaagcatactttatcgattacattgcctccttacagcagaagagctgagagcgcaaacagctattgatgctggggtaggagtcaaatcgcttcctgatgatttccgatacccaaacttggattttggatggaaacgatctatagacagtaaaacattcatctctaatcaaagttcctcatcagtcgagagtgaaagtgactgcagactcaataaaaccacggcccctgacagtgctgcaagctcagctgctaattctgtaatctacatgcaaatcaatgaccaaatgtctgtgaactgcacaccaccatgtcaaaaatctctgagtcacctccaaacagtttgcttctcagatgattacaaagcaattaacggtatttcttgcaatggtcttaccaatggtgattgggaagcagaaagcgctgcatgtttccaaaaggacgaacggataacctgcaaacaggaaatacctgaaaaatctacctcgtttcacgttcagaatttacctaaggagaaccagcccatacttaaagaatgtactctgagcaactctgatggaaatgtcagcaaacctacctcagatgagtgccctagcacctgtacttcagacatgcattatgatagtgggctttccaataggcactcttcaaaaactcttggcccaaaccctggtcttatccttcaggccttgactctgtccaatgcaagtgatggtttcaatctggagcgtcttgaaatgcttggggactctttcttaaaacatgctatcaccacatatctgttctgcacatacccagatgctcacgagggccgtctatcctatatgcgcagcaagaaggtcagtaactgtaacctttatcggcttggaaaaaagaaaggctcacccagccggatggtggtgtccattttcgatccacctgtcaactggcttccccctggttatattgttaaccaggacaaaaactctgataagtgggaaagtaatgaaacgtctggtgaggatgtgatggttaatggcaaaattgatgaagactttgatgatgaagaagatgaagatcttatgtggaggaatcccaaagaggaaactgattttgatgatgactttttggaatatgatcaagagcatataaaattcattgacagcatgttaatgggatctggggcatttgtgaagaaaattcctctttcttcatttgcaccccctgatcagaactatgaatggagggcgccaaagaaacctccactggaaagttctcaatttccctgcgattttgatgattttgattacagttcttgggatgccatgtgttatttggatcccagcaaggctgtagaggaggatgactttgtagtaggcttttggaatccatcagaagagaactgtggagctgatgctggaaagcagtctatatcttatgacctacacacagagcagtgtattgcagacaaaagtatagctgactgtgtagaggctttattaggctgctatctgaccagttgtggtgagagagctgcacaactgtttctttgttctttgggcttaaaagtgctcccagaagtaagaaagcttgttacaaacacaaatgtcattagtgcatcatcatcttaccagaacagtaccagagacaactgcactcttactgccagaaccaacactgatctgtcctcctgcaaaggcatagactacggttatttaaagattcccccaaggtgtatgtttgagcacccagatgctgagaaaacccttgaccatctaatatctggttttgaaaactttgagaagaaaataaactatccatttaaaaacaaggcttaccttctacaggcttttacacatgcctcttaccactacaatactataactgactgctaccagcgtttagaatttcttggagatgcaattttggactacctcattactaagcacctttatgaagatccacgccagcactcgccaggagtcctcactgacctgcgctctgctcttgtgaataacaccatatttgcatcactagctgtgaaatatgactaccataaatacttcaaggctatctctcctgaactgttccatgtaattgatgattttgtgcaatttcaacttgaaaaaaatgaaatgcaaggcatggattctgagttacgtaggtctgaagaagacgaagagaaagaagaggacattgaagtcccaaaagctatgggagacatatttgagtcacttgcaggagctatttacatggacagcggcatgtctttggaaactgtatggcatgtgtattatcctatgatgcagccattaatagaaaaattctctgctaatgttcctcgttccccagtgagagaattactggaaatggagcctgaaactgctaaattcagtccagccgaaagaacatacgatggaaaagtcagagtgactgtggaagttgttggaaaaggaaaatttaaaggagtcggaagaagttacagaattgccaaatctgcagcagccaggagagcactaagaagcctcaaagcaaatcaatctcaggtccctaacagctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]