2024-09-29 08:57:43, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001097510 1701 bp mRNA linear MAM 18-FEB-2022 DEFINITION Sus scrofa cytoplasmic polyadenylation element binding protein 1 (CPEB1), mRNA. ACCESSION NM_001097510 VERSION NM_001097510.1 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. REFERENCE 1 (bases 1 to 1701) AUTHORS Komrskova P, Susor A, Malik R, Prochazkova B, Liskova L, Supolikova J, Hladky S and Kubelka M. TITLE Aurora kinase A is not involved in CPEB1 phosphorylation and cyclin B1 mRNA polyadenylation during meiotic maturation of porcine oocytes JOURNAL PLoS ONE 9 (7), e101222 (2014) PUBMED 24983972 REMARK GeneRIF: Aurora kinase A is unlikely to be involved in CPEB1 activating phosphorylation and cyclin B1 mRNA polyadenylation during meiotic maturation of porcine oocytes. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1701) AUTHORS Nishimura Y, Kano K and Naito K. TITLE Porcine CPEB1 is involved in Cyclin B translation and meiotic resumption in porcine oocytes JOURNAL Anim. Sci. J. 81 (4), 444-452 (2010) PUBMED 20662813 REMARK GeneRIF: results suggest the involvement of mammalian CPEB1 in Cyclin B syntheses and meiotic resumption in mammalian oocytes COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB277271.1. ##Evidence-Data-START## Transcript exon combination :: AB277271.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103886149, SAMN04484925 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1701 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="7" /map="7" gene 1..1701 /gene="CPEB1" /note="cytoplasmic polyadenylation element binding protein 1" /db_xref="GeneID:100048944" CDS 1..1701 /gene="CPEB1" /codon_start=1 /product="cytoplasmic polyadenylation element-binding protein 1" /protein_id="NP_001090979.1" /db_xref="GeneID:100048944" /translation="
MASPLEEEAGKIKDCWDNQEAPALSTCSNANIFRRINTILDNSLDFSRVCTTPINRGIHDHLPDFQDSEETVTSRMLFPTSAQDSSRGLPDANDLCLGLQSLSLIGWDRPWSTQDSDSSAQSGTHSVLSMLHNPLGNVLGKPPLSFLPLDPLGSDLVDKFPAPSVRRSRLDTRPILDSRSSSPSDSDTSGFSSGSDHLSDLISSLRISPPLPFLSLTGGGPRDPLKMGVGSRMDQEQAALAAVTPSPTSASKRWPGASVWPSWDLLEAPKDPFSIEREARLHRQAAAVNEATCTWSGQLPPRNYKNPIYSCKVFLGGVPWDITEAGLVNTFRVFGSLSVEWPGKDGKHPRCPPKGNTPKGYVYLVFELEKSVRALLQACSRDSLNPDGLSEYYFKMSSRRMRCKEVQVIPWVLADSNFVRSPSQRLDPSRTVFVGALHGMLNAEALAAILNDLFGGVVYAGIDTDKHKYPIGSGRVTFNNQRSYLKAVSAAFVEIKTTKFTKKVQIDPYLEDSLCHICSSQPGPFFCRDQVCFKYFCRSCWHWRHSVEGLRHHSPLMRNQKNRDAS"
misc_feature 1..921 /gene="CPEB1" /note="Cytoplasmic polyadenylation element-binding protein 1 N-terminus; Region: CEBP1_N; pfam16368" /db_xref="CDD:465107" misc_feature 925..1248 /gene="CPEB1" /note="RNA recognition motif 1 (RRM1) found in cytoplasmic polyadenylation element-binding protein 1 (CPEB-1) and similar proteins; Region: RRM1_CPEB1; cd12723" /db_xref="CDD:410122" misc_feature 1279..1530 /gene="CPEB1" /note="RNA recognition motif 2 (RRM2) found in cytoplasmic polyadenylation element-binding protein 1 (CPEB-1) and similar proteins; Region: RRM2_CPEB1; cd12725" /db_xref="CDD:410124" misc_feature 1510..1677 /gene="CPEB1" /note="Cytoplasmic polyadenylation element-binding protein ZZ domain; Region: CEBP_ZZ; pfam16366" /db_xref="CDD:465105" ORIGIN
atggcgtccccgctggaagaagaggcaggaaagataaaagattgctgggacaaccaggaagcacctgcactctccacgtgtagcaatgccaatatctttcgaaggataaataccatactggataattctctggatttcagcagagtctgcactacacccataaatcgaggaattcatgatcatttgccagacttccaggactctgaagaaacagttacaagcaggatgcttttccccacctctgcgcaagattcttcccgtggcctcccagatgcaaatgacttgtgccttggcctgcagtccctcagtctcataggctgggaccgaccctggagcacccaggactcagattcctcagcccagagcggcacacactccgtactgagcatgctccacaacccactgggcaatgtcctggggaaaccccccttgagcttcctgcctctggacccccttggatctgacttggtggacaagtttccagcaccctcagttagacgatcccgcctggacacccggcccatcttggactcccgttctagcagcccctctgactcagataccagtggcttcagctctggatcagatcatctctcagatttgatttcaagcctccgaatttcccctcccctgcccttcctgtctctgacagggggtggtcccagagaccctttaaagatgggagttgggtcccggatggaccaagagcaagctgctctggctgcagtcactccttccccaaccagtgcatcaaaaagatggccaggagcttctgtgtggccatcctgggacctcctcgaagctcccaaagaccccttcagcatagagagagaggccaggctacacaggcaagctgcagctgtgaatgaagccacctgtacctggagtggccagcttcctccccggaactataagaaccccatctactcttgcaaggtgttcctaggaggtgttccttgggatattacggaagctggattggttaacaccttccgtgtttttggctctttgagtgtggagtggcctggtaaggatggcaagcacccccggtgtcctcccaaaggtaatacgcctaaagggtatgtgtatctggtcttcgaactagagaagtctgtccgggccttgcttcaggcttgttctcgtgactcactgaacccagatggcctgagtgaatattacttcaagatgtccagccgaaggatgcgctgcaaggaggtacaagtgatcccctgggtcttggctgacagcaactttgttcggagcccatctcagagacttgaccccagcaggacggtgtttgtcggtgccctgcatggaatgctcaatgccgaggccctggcagccattctgaacgacctatttggtggcgtggtgtatgctgggattgacactgataagcacaagtatcccattgggtctggacgtgtgactttcaataaccaacgtagttacctgaaagcagtcagtgctgctttcgtggagatcaaaaccaccaagttcaccaagaaggttcagattgacccctacctggaagattctctgtgtcatatctgcagttctcagcctggtcctttcttctgtcgtgatcaggtgtgcttcaagtacttctgccgaagctgctggcactggcggcacagcgtggagggcctacgccaccacagcccattgatgcggaaccagaagaaccgagatgccagctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]