GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-28 11:34:46, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001097510            1701 bp    mRNA    linear   MAM 02-APR-2025
DEFINITION  Sus scrofa cytoplasmic polyadenylation element binding protein 1
            (CPEB1), mRNA.
ACCESSION   NM_001097510
VERSION     NM_001097510.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1701)
  AUTHORS   Komrskova,P., Susor,A., Malik,R., Prochazkova,B., Liskova,L.,
            Supolikova,J., Hladky,S. and Kubelka,M.
  TITLE     Aurora kinase A is not involved in CPEB1 phosphorylation and cyclin
            B1 mRNA polyadenylation during meiotic maturation of porcine
            oocytes
  JOURNAL   PLoS One 9 (7), e101222 (2014)
   PUBMED   24983972
  REMARK    GeneRIF: Aurora kinase A is unlikely to be involved in CPEB1
            activating phosphorylation and cyclin B1 mRNA polyadenylation
            during meiotic maturation of porcine oocytes.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1701)
  AUTHORS   Nishimura,Y., Kano,K. and Naito,K.
  TITLE     Porcine CPEB1 is involved in Cyclin B translation and meiotic
            resumption in porcine oocytes
  JOURNAL   Anim Sci J 81 (4), 444-452 (2010)
   PUBMED   20662813
  REMARK    GeneRIF: results suggest the involvement of mammalian CPEB1 in
            Cyclin B syntheses and meiotic resumption in mammalian oocytes
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB277271.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB277271.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103886149, SAMN04484925
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1701
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="7"
                     /map="7"
     gene            1..1701
                     /gene="CPEB1"
                     /note="cytoplasmic polyadenylation element binding protein
                     1"
                     /db_xref="GeneID:100048944"
                     /db_xref="RGD:14083864"
     CDS             1..1701
                     /gene="CPEB1"
                     /codon_start=1
                     /product="cytoplasmic polyadenylation element-binding
                     protein 1"
                     /protein_id="NP_001090979.1"
                     /db_xref="GeneID:100048944"
                     /db_xref="RGD:14083864"
                     /translation="
MASPLEEEAGKIKDCWDNQEAPALSTCSNANIFRRINTILDNSLDFSRVCTTPINRGIHDHLPDFQDSEETVTSRMLFPTSAQDSSRGLPDANDLCLGLQSLSLIGWDRPWSTQDSDSSAQSGTHSVLSMLHNPLGNVLGKPPLSFLPLDPLGSDLVDKFPAPSVRRSRLDTRPILDSRSSSPSDSDTSGFSSGSDHLSDLISSLRISPPLPFLSLTGGGPRDPLKMGVGSRMDQEQAALAAVTPSPTSASKRWPGASVWPSWDLLEAPKDPFSIEREARLHRQAAAVNEATCTWSGQLPPRNYKNPIYSCKVFLGGVPWDITEAGLVNTFRVFGSLSVEWPGKDGKHPRCPPKGNTPKGYVYLVFELEKSVRALLQACSRDSLNPDGLSEYYFKMSSRRMRCKEVQVIPWVLADSNFVRSPSQRLDPSRTVFVGALHGMLNAEALAAILNDLFGGVVYAGIDTDKHKYPIGSGRVTFNNQRSYLKAVSAAFVEIKTTKFTKKVQIDPYLEDSLCHICSSQPGPFFCRDQVCFKYFCRSCWHWRHSVEGLRHHSPLMRNQKNRDAS"
     misc_feature    1..921
                     /gene="CPEB1"
                     /note="Cytoplasmic polyadenylation element-binding protein
                     1 N-terminus; Region: CEBP1_N; pfam16368"
                     /db_xref="CDD:465107"
     misc_feature    925..1248
                     /gene="CPEB1"
                     /note="RNA recognition motif 1 (RRM1) found in cytoplasmic
                     polyadenylation element-binding protein 1 (CPEB-1) and
                     similar proteins; Region: RRM1_CPEB1; cd12723"
                     /db_xref="CDD:410122"
     misc_feature    1279..1530
                     /gene="CPEB1"
                     /note="RNA recognition motif 2 (RRM2) found in cytoplasmic
                     polyadenylation element-binding protein 1 (CPEB-1) and
                     similar proteins; Region: RRM2_CPEB1; cd12725"
                     /db_xref="CDD:410124"
     misc_feature    1510..1677
                     /gene="CPEB1"
                     /note="Cytoplasmic polyadenylation element-binding protein
                     ZZ domain; Region: CEBP_ZZ; pfam16366"
                     /db_xref="CDD:465105"
ORIGIN      
atggcgtccccgctggaagaagaggcaggaaagataaaagattgctgggacaaccaggaagcacctgcactctccacgtgtagcaatgccaatatctttcgaaggataaataccatactggataattctctggatttcagcagagtctgcactacacccataaatcgaggaattcatgatcatttgccagacttccaggactctgaagaaacagttacaagcaggatgcttttccccacctctgcgcaagattcttcccgtggcctcccagatgcaaatgacttgtgccttggcctgcagtccctcagtctcataggctgggaccgaccctggagcacccaggactcagattcctcagcccagagcggcacacactccgtactgagcatgctccacaacccactgggcaatgtcctggggaaaccccccttgagcttcctgcctctggacccccttggatctgacttggtggacaagtttccagcaccctcagttagacgatcccgcctggacacccggcccatcttggactcccgttctagcagcccctctgactcagataccagtggcttcagctctggatcagatcatctctcagatttgatttcaagcctccgaatttcccctcccctgcccttcctgtctctgacagggggtggtcccagagaccctttaaagatgggagttgggtcccggatggaccaagagcaagctgctctggctgcagtcactccttccccaaccagtgcatcaaaaagatggccaggagcttctgtgtggccatcctgggacctcctcgaagctcccaaagaccccttcagcatagagagagaggccaggctacacaggcaagctgcagctgtgaatgaagccacctgtacctggagtggccagcttcctccccggaactataagaaccccatctactcttgcaaggtgttcctaggaggtgttccttgggatattacggaagctggattggttaacaccttccgtgtttttggctctttgagtgtggagtggcctggtaaggatggcaagcacccccggtgtcctcccaaaggtaatacgcctaaagggtatgtgtatctggtcttcgaactagagaagtctgtccgggccttgcttcaggcttgttctcgtgactcactgaacccagatggcctgagtgaatattacttcaagatgtccagccgaaggatgcgctgcaaggaggtacaagtgatcccctgggtcttggctgacagcaactttgttcggagcccatctcagagacttgaccccagcaggacggtgtttgtcggtgccctgcatggaatgctcaatgccgaggccctggcagccattctgaacgacctatttggtggcgtggtgtatgctgggattgacactgataagcacaagtatcccattgggtctggacgtgtgactttcaataaccaacgtagttacctgaaagcagtcagtgctgctttcgtggagatcaaaaccaccaagttcaccaagaaggttcagattgacccctacctggaagattctctgtgtcatatctgcagttctcagcctggtcctttcttctgtcgtgatcaggtgtgcttcaagtacttctgccgaagctgctggcactggcggcacagcgtggagggcctacgccaccacagcccattgatgcggaaccagaagaaccgagatgccagctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]