2024-05-19 04:40:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017356693 6534 bp mRNA linear VRT 15-JUN-2017 DEFINITION PREDICTED: Danio rerio cell adhesion molecule L1-like b (chl1b), transcript variant X8, mRNA. ACCESSION XM_017356693 VERSION XM_017356693.2 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007117.7) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jun 15, 2017 this sequence version replaced XM_017356693.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Danio rerio Annotation Release 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6534 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="6" gene 1..6534 /gene="chl1b" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 ESTs, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 92 samples with support for all annotated introns" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" CDS 351..3965 /gene="chl1b" /codon_start=1 /product="neural cell adhesion molecule L1-like protein isoform X7" /protein_id="XP_017212182.2" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" /translation="
MRLLRKTLLLLAACLNMSSRYQTNALEIPLDVLERMNMEQLPTITEYSPASLIAFPFEESFPVKCEATGNPEPEFRWTKNGQDFDPYQDTRLITLDDSGTFIIPNTGNLTEFQGIYRCFATNKLGTAMSEEIEFIIPNVPKFPKEIIDPIEVMEGQSVILECNPPTGIPPLQIYWMTISLQHIEQDERVSVGLNGNLYFSNTVETDSRRDYCCFAAFPRIRTIVQKTAMSMVVKSNKLMKDSSSGSGRGYANSLLERKPSLLAPTGMESHTRLVKGEDLQLECIAEGFPTPKVEWVKIGFNKLPERVVVESHGKLLTVEMVNEEDEGKYMCRAKNPHGEVVHHFHVTVEEPPEFEIEPQSQLVTIGADVLIKCVVKGNPQPTVGWRVNGRPLNEVPTSNRKILKDGTISIHNANPENSAVYQCEATNKHGTILANANIMIMNIQPLILTENNLQYMAVEGKSVVMHCKVFSSPASSITWSKADSANAVEGERFTVHQNGSLEIHNVMKEDMGEYSCFAQNTEGKVAIAATLEVKDPTRIVDPPRDLRVLAGTTIQFSCQPEFDPSFGDDFEVLWEKDGIALNGSEDGRYILEDGVLEIINVSFGDQGFYACVARTPVDQDVAVAQLSVVDVPDPPEDVILSEHNGRSVKLQWTPGDDHNSSITEFVLEFEESQHEPGSWREMMRVPGNHHSAPLKLYGHVDYRFRVSAINEVGKGRPSQSTERYKTPASAPDKNPENIKIEAHLPHEMDINWEPLSPIEHNGPGLEYKVSYRRHGSDEDWTERMVKRHSFLVKNTPTFVLYEIKIQAKNHAGWGPDPKIITAYSGEDFPSAAPDDVAVEVLNNTMVKVRWEHVHKDKIHGHLGGYRVSWWRLRSLLDSKKTHGDKHTLTFSGERNHAVVTGLKPFSEYSLIVMAFNSRGNGPGSHSVNFKTPEGVPGQAAAFSATNIQKHKVTLTWSPPVDANGVLIGYILQYQLINNTEELGPLMTLNISADSNKQHLENLEALSKYKFYLRCCTRVGCGPAVSEERTTVPEATSTDVASFNIRKSSSRFPPRKTTVSPVANATLSSIGLASIHGSISNQGWFIGLMCAIALLTLIVLIACFVNRNKGGKYSVKEKEDLHPDLESQGINDDTFCEYSDNDEKPLKSSQHSLNGDLKGGDSGDSMVDYCDEDAHFNEDGSFIGEYSGRKDRASMEIKGNNQSTA"
misc_feature 474..755 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 531..545 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 570..584 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 645..659 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 693..710 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 735..746 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 780..1052 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 822..836 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 864..878 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 933..947 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 978..995 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1026..1037 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1149..1394 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1185..1199 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1224..1238 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1290..1304 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1332..1349 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1371..1382 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1425..1664 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1455..1469 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1494..1508 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1566..1580 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1608..1625 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1647..1658 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1689..1949 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1737..1751 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1776..1790 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1845..1859 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1887..1904 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1926..1937 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1953..2255 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2010..2024 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2061..2075 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2130..2144 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2172..2189 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2211..2222 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2244..2516 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(2244..2246,2442..2444,2487..2489) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(2490..2495,2499..2504) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 2550..2795 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature 2844..3143 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(3108..3113,3117..3122) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature order(3156..3158,3360..3362,3405..3407) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature 3174..3416 /gene="chl1b" /note="Fibronectin type III domain; Region: fn3; pfam00041" /db_xref="CDD:394996" misc_feature order(3408..3413,3417..3422) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 3666..3917 /gene="chl1b" /note="Bravo-like intracellular region; Region: Bravo_FIGEY; pfam13882" /db_xref="CDD:433552" ORIGIN
aagcgctcagatctggctttgtgggagtgattgtcactcgtttaatgagcttctttgccaggcgagaggctttggcaacatatgtctccccagtcgcctctctcgctctgttagtaccgggtctgctgtggtggacgtttctctggattttcttctctttctcaagcctgtgggattagacagagcagaaaaggaagggtttgtctgtatttctgaggacgagcggactagaatgaagcagattcctgtagcgagaccacagcctgggttggagtgagatgcactgactcctggcagactgcagatttccctgtcatcctccgctctcgcctctgaaactgtggccagtcatgcggttgttacggaaaaccctgcttcttttggctgcttgccttaatatgagcagcaggtatcaaactaacgccctggaaattccacttgatgttttagagcgcatgaacatggagcagctgcccacaattacagagtactctcctgcctcgctcatcgccttccctttcgaagagagcttccctgtgaagtgtgaggccacaggaaaccctgaaccagaattcaggtggacaaagaacggccaagactttgatccgtatcaggacaccagattgataacgttagatgattccggaacattcatcattcccaataccggaaatctcactgaattccagggcatttatcgctgttttgcaaccaacaaattggggacagccatgtcagaagaaattgagttcattattcctaatgtcccaaagttccccaaagagatcatcgatccgattgaggtgatggaaggtcagtcagtcattctagagtgcaatccacctacagggatccctccattgcaaatctactggatgacaataagtctacagcacatcgagcaggacgaaagagtgtcagtgggtctgaatggaaacctgtacttctcaaacaccgttgaaactgatagccgcagagactattgctgctttgctgccttccctcgcatccgaactatcgtccagaaaaccgctatgtccatggtggtcaaaagcaacaagttaatgaaggactcaagctctggtagcggcagaggttatgcaaactccctgttggagaggaagcccagcctgttggcgcctacaggaatggagtcacatacacgcctggtgaaaggtgaagatcttcagttggagtgtatagcagagggattccccacgccaaaggtggaatgggttaaaataggcttcaacaagcttccagaaagggttgttgtggagagtcatgggaagctgctcactgttgagatggtgaatgaggaggatgaaggcaaatatatgtgcagagccaaaaatccccacggagaggtggtgcatcattttcatgtgacagtagaggagcctcctgagtttgagattgaacctcaaagccaactggtgacgattggagctgatgtattgatcaagtgtgtcgtgaaaggaaatcctcaacctactgtaggatggagagttaacgggcggccactgaacgaggtcccaacatccaacaggaagatcttgaaagatggcacaatttccatccacaatgcaaacccagaaaacagtgctgtttaccaatgcgaggcaaccaacaaacacggcaccatcctggccaatgccaacatcatgattatgaacatccagccgctgatcttaacagaaaacaatctgcaatatatggcggtggaggggaaaagtgtggtcatgcactgcaaggtcttcagctctccagcctccagcattacgtggagtaaagctgacagtgcaaatgcagtggaaggagaacggtttactgttcaccagaatggttcactggagatccataatgtgatgaaagaggacatgggagagtattcttgctttgcacaaaacaccgaaggcaaagttgccattgctgcaacacttgaagtcaaagatcccaccagaatagtcgatcctccacgtgatttgcgggttttggcgggaaccactattcagttttcatgccagccagagtttgatccctcttttggtgatgactttgaagtcctgtgggagaaagatggcattgccctcaacggcagcgaagatggaagatatatcctggaagacggagtgctggagatcattaatgtgagtttcggagaccagggcttttacgcgtgtgtggccagaacgcccgttgaccaagacgttgcagtggcacagctttcagtcgtggatgttcctgatccaccagaggatgtgatactgtctgaacataatggccgaagtgtgaaactgcagtggactccgggagatgaccataatagctccattaccgagtttgttctagagtttgaagaaagccaacatgagccaggcagctggagggagatgatgagagtcccaggaaaccatcactcagctccgctgaagctttatggacatgtggactaccgcttcagagtctccgccatcaacgaggtgggcaaaggtcggccaagccagtccactgaaagatacaaaactccagcatcagcacccgacaagaacccagaaaatatcaagatcgaagctcatttgccacatgaaatggatatcaactgggagccgttgtcacctattgaacacaacgggcctggtctggagtacaaagtgagctacaggagacatggcagcgatgaagactggacggagcgcatggtgaagaggcactcatttctggtcaaaaacaccccgacgttcgtcctttacgagatcaaaattcaggccaagaaccacgcgggctggggtccggaccctaaaataataacagcgtactcgggagaggatttcccctcagcagctccagatgatgtagccgtagaagtgttgaacaacactatggtgaaggtcagatgggaacatgttcacaaggacaaaatacatggacatctgggtggctacagggtgagctggtggaggcttcgtagtctgctggactcaaagaaaacacacggcgacaagcacacattgacattctcaggcgagaggaaccatgcggtggtcacaggtcttaagccgttctccgaatacagcctcattgtcatggcctttaacagcagaggaaacggtcctggcagtcattcggtcaacttcaaaacccctgagggagttcctggtcaagcagctgctttcagtgctacaaacatccagaagcacaaggtcaccttgacctggtctcctccagttgacgcaaatggagtcctaattggctacatcctccaatatcagctaataaacaacacagaggaactaggccctctgatgacactcaacatctccgccgacagcaataagcagcacctcgaaaacctggaagccctgagcaaatacaaattttaccttcggtgttgcacgcgggtgggctgcggtcctgcggtcagcgaggagcgcaccaccgtccctgaagccacttcaacagatgtggcctctttcaacatcagaaaatccagctcacgatttcctccaagaaaaaccactgtttcccctgtggctaatgctactctttcttctataggtctggccagcattcatggaagcatctcaaaccagggatggttcatcggactcatgtgtgccatagcgcttctcaccctcattgtgctcatagcgtgctttgtcaaccgaaacaaaggcggcaaatactcagtaaaagagaaggaagacctccaccccgacctggagtcccagggcataaatgatgacaccttctgtgaatacagtgataatgatgagaaaccgctgaaaagcagccagcattcattgaatggcgacttgaaaggaggagacagcggagacagcatggtggactactgtgatgaggacgctcacttcaacgaggacggctcttttatcggagaatactctggacgcaaggacagggcctccatggaaatcaagggaaacaatcagagcacagcgtaatggaccacggacaatttatttgttggacaagctctcacaaaaggtcagtcaaaaggaagcggagggaataaaagtgtggcgtaacagcacccgaaggacatttttgcaattaatgtgttattgtcaaatcctcagtcatactcacatcattttttacagggcttagttgtttccatttttttctgcgtgctgttactgatcaatcatgtcagttgtgtatacttttgtgaggtgtttttgtattaaatctttgcaaatcattgatgactgccgggaaagttctgctttcaacgtcatcatgtagccaagccagtttttctgtcagggtatatgaactttgtatttttatttttcattccaggcaaatattattgacattttatatttcagacactgtatactgtgcgttcattaaatgtgggttattatgtgtacaaaaggagttgttgcttaaataatcataagttctgttaaaatccaaaaaaaatgaaagaaagcgtaaggcgatgtaagggtttacaattagtgtaaaatgctttgatgaacagtttcacattgagctatactaacaagcttaatagccatattcagcaccacataaaccctacagtgcatctgctgctgttttaaccctttacatacagtataatacagtattttatcaaaaagacacctaatgttcatacatttaaagaaaaaaaaatgcctcaattgccttataatgactttgaatctggtaagtaagatataacaatggggtatgtgcacatggagttttaatttcagccagccagcctcagtgtttccggtgaactgtctttcctttataaaatcgccacgtttaagatctggtttcgttagaaatcagtgatcctcactgcctgatagatatacaatgtgaagagggtctcagatcgaaaaaagaagcactgcatttaatttcattttccctttccatgtctttaaaatatgtacaattaatttttgtattttcaattgagtttctgcattagcctgctgatactgatggcgtgtcacagatgttttcatactgcatgactatctagggtagcattctgttagtgatgtgtttacattttaggatggattggcgacagggggtttcacactgcatgactttacagtaggaagaatcgccgttgactttgtccaaactttgtctcacaatcaaacacacaagagaagtgacatggaaaaggatgtccgcgaggtcctaaaatgtattaaaagttgattaatcaattaagagaaaattaaagcttaaaaggtatttaaaaagtcttaatcacacttttacgaggttttataaattagctcaagcattgtccaaagtgtttgattccaaaaagtataatatatttatggctcgatccacgcgattggttcaggccggggtatgtccggccaagctcctccgttcgagtgatgtcacgtaatttgcaacaaatacgggaaggtgatgctctccacatgtagcgaaaccatagagcgaaacagacggcaaaatgagaaaatgtaagtactcctggttggagaaagacgagtttaaacagtagctgaagcctgtcgtttaaaacaaccacgtaatttattctttcaagctttgtttcttcttgagttctgttgcatgattatgctctattgatttaactacaacacgtagtgtatcttgggttatcaaccatatgcctttagtggggtagcaaatgtacttatttctcctcaacattttattctttatcgatccagttgtggtgttgctcagatgacatgtcaaacagatgcgtgtgctcctgccaaatttccatagttttcctccttttcttggatccaaataaactgagattgagcgcttttaacttctccctgctgatacccatactagcggatgcagctctctcattggctgcaggtaatcgcaaatgttattttcaatcagaacacatttcacacagcatgatttgaatcgccgacagacccaaatatttagcacgccaaatatctcaagggtgtcagcgactcatctgggattctctcagatcgcgtctttgatagttcatactgtgtgattgttactcacatgaatgagcaacgattcacttttgatttcaggcatttgtctgcgatttctcaaaacctgtcggcaaaaaatctgggctaaactcttgcagtctgaactcggcataagtctatttaactgaatgtatttgaattacattataacattgatgctgtaaaaggaacattatgaaactgagaatgtctggctggaaacactagctgtgcatataccccattctcatggattccgtgatacagggttggaattctacaaattccacattggcatcctttgaaatatttctcttcacaaacggacagttctgaaagccaacaagtcttgtttgaacaattctgtatgtttttttgcaatggctccacatatagagtcaaagccagattctgtacaatgttctgtgaattctgtttgcatgttgaaagaggtctgtgtgcagatttgacattaaattgtatcatttctttcttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]