2024-05-19 05:12:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017356690 6742 bp mRNA linear VRT 15-JUN-2017 DEFINITION PREDICTED: Danio rerio cell adhesion molecule L1-like b (chl1b), transcript variant X5, mRNA. ACCESSION XM_017356690 VERSION XM_017356690.2 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007117.7) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jun 15, 2017 this sequence version replaced XM_017356690.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Danio rerio Annotation Release 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6742 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="6" gene 1..6742 /gene="chl1b" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 ESTs, 13 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" CDS 352..4173 /gene="chl1b" /codon_start=1 /product="neural cell adhesion molecule L1-like protein isoform X4" /protein_id="XP_017212179.2" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" /translation="
MRLLRKTLLLLAACLNMSSRYQTNALEIPLDVEQLPTITEYSPASLIAFPFEESFPVKCEATGNPEPEFRWTKNGQDFDPYQDTRLITLDDSGTFIIPNTGNLTEFQGIYRCFATNKLGTAMSEEIEFIIPNVPKFPKEIIDPIEVMEGQSVILECNPPTGIPPLQIYWMTISLQHIEQDERVSVGLNGNLYFSNTVETDSRRDYCCFAAFPRIRTIVQKTAMSMVVKSTNSLLERKPSLLAPTGMESHTRLVKGEDLQLECIAEGFPTPKVEWVKIGFNKLPERVVVESHGKLLTVEMVNEEDEGKYMCRAKNPHGEVVHHFHVTVEEPPEFEIEPQSQLVTIGADVLIKCVVKGNPQPTVGWRVNGRPLNEVPTSNRKILKDGTISIHNANPENSAVYQCEATNKHGTILANANIMIMNIQPLILTENNLQYMAVEGKSVVMHCKVFSSPASSITWSKADSANAVEGERFTVHQNGSLEIHNVMKEDMGEYSCFAQNTEGKVAIAATLEVKDPTRIVDPPRDLRVLAGTTIQFSCQPEFDPSFGDDFEVLWEKDGIALNGSEDGRYILEDGVLEIINVSFGDQGFYACVARTPVDQDVAVAQLSVVDVPDPPEDVILSEHNGRSVKLQWTPGDDHNSSITEFVLEFEESQHEPGSWREMMRVPGNHHSAPLKLYGHVDYRFRVSAINEVGKGRPSQSTERYKTPASAPDKNPENIKIEAHLPHEMDINWEPLSPIEHNGPGLEYKVSYRRHGSDEDWTERMVKRHSFLVKNTPTFVLYEIKIQAKNHAGWGPDPKIITAYSGEDFPSAAPDDVAVEVLNNTMVKVRWEHVHKDKIHGHLGGYRVSWWRLRSLLDSKKTHGDKHTLTFSGERNHAVVTGLKPFSEYSLIVMAFNSRGNGPGSHSVNFKTPEGVPGQAAAFSATNIQKHKVTLTWSPPVDANGVLIGYILQYQLINNTEELGPLMTLNISADSNKQHLENLEALSKYKFYLRCCTRVGCGPAVSEERTTVPEATSTDVASFNIRKSSSRFPPRKTTVSPVANATLSSIAVLNISTSVSHNYANISWIPGTEQTESELYVAFMNNREGNWKISDMLNSSKTFHIIEGLEPGTEYTVRLMTKSWVDNSSIFEDVIRTRAKGLASIHGSISNQGWFIGLMCAIALLTLIVLIACFVNRNKGGKYSVKEKEDLHPDLESQGINDDTFCEYSDNDEKPLKSSQHSLNGDLKGGDSGDSMVDYCDEDAHFNEDGSFIGEYSGRKDRASMEIKGNNQSTA"
misc_feature 457..738 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 514..528 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 553..567 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 628..642 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 676..693 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 718..729 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 763..1035 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 805..819 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 847..861 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 916..930 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 961..978 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1009..1020 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1087..1332 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1123..1137 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1162..1176 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1228..1242 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1270..1287 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1309..1320 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1363..1602 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1393..1407 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1432..1446 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1504..1518 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1546..1563 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1585..1596 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1627..1887 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1675..1689 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1714..1728 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1783..1797 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1825..1842 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1864..1875 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1891..2193 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1948..1962 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1999..2013 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2068..2082 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2110..2127 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2149..2160 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2182..2454 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(2182..2184,2380..2382,2425..2427) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(2428..2433,2437..2442) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 2488..2733 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature 2782..3081 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(3046..3051,3055..3060) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature order(3094..3096,3298..3300,3343..3345) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature 3112..3354 /gene="chl1b" /note="Fibronectin type III domain; Region: fn3; pfam00041" /db_xref="CDD:394996" misc_feature order(3346..3351,3355..3360) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 3496..3714 /gene="chl1b" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 3874..4125 /gene="chl1b" /note="Bravo-like intracellular region; Region: Bravo_FIGEY; pfam13882" /db_xref="CDD:433552" ORIGIN
aaagcgctcagatctggctttgtgggagtgattgtcactcgtttaatgagcttctttgccaggcgagaggctttggcaacatatgtctccccagtcgcctctctcgctctgttagtaccgggtctgctgtggtggacgtttctctggattttcttctctttctcaagcctgtgggattagacagagcagaaaaggaagggtttgtctgtatttctgaggacgagcggactagaatgaagcagattcctgtagcgagaccacagcctgggttggagtgagatgcactgactcctggcagactgcagatttccctgtcatcctccgctctcgcctctgaaactgtggccagtcatgcggttgttacggaaaaccctgcttcttttggctgcttgccttaatatgagcagcaggtatcaaactaacgccctggaaattccacttgatgtggagcagctgcccacaattacagagtactctcctgcctcgctcatcgccttccctttcgaagagagcttccctgtgaagtgtgaggccacaggaaaccctgaaccagaattcaggtggacaaagaacggccaagactttgatccgtatcaggacaccagattgataacgttagatgattccggaacattcatcattcccaataccggaaatctcactgaattccagggcatttatcgctgttttgcaaccaacaaattggggacagccatgtcagaagaaattgagttcattattcctaatgtcccaaagttccccaaagagatcatcgatccgattgaggtgatggaaggtcagtcagtcattctagagtgcaatccacctacagggatccctccattgcaaatctactggatgacaataagtctacagcacatcgagcaggacgaaagagtgtcagtgggtctgaatggaaacctgtacttctcaaacaccgttgaaactgatagccgcagagactattgctgctttgctgccttccctcgcatccgaactatcgtccagaaaaccgctatgtccatggtggtcaaaagcacaaactccctgttggagaggaagcccagcctgttggcgcctacaggaatggagtcacatacacgcctggtgaaaggtgaagatcttcagttggagtgtatagcagagggattccccacgccaaaggtggaatgggttaaaataggcttcaacaagcttccagaaagggttgttgtggagagtcatgggaagctgctcactgttgagatggtgaatgaggaggatgaaggcaaatatatgtgcagagccaaaaatccccacggagaggtggtgcatcattttcatgtgacagtagaggagcctcctgagtttgagattgaacctcaaagccaactggtgacgattggagctgatgtattgatcaagtgtgtcgtgaaaggaaatcctcaacctactgtaggatggagagttaacgggcggccactgaacgaggtcccaacatccaacaggaagatcttgaaagatggcacaatttccatccacaatgcaaacccagaaaacagtgctgtttaccaatgcgaggcaaccaacaaacacggcaccatcctggccaatgccaacatcatgattatgaacatccagccgctgatcttaacagaaaacaatctgcaatatatggcggtggaggggaaaagtgtggtcatgcactgcaaggtcttcagctctccagcctccagcattacgtggagtaaagctgacagtgcaaatgcagtggaaggagaacggtttactgttcaccagaatggttcactggagatccataatgtgatgaaagaggacatgggagagtattcttgctttgcacaaaacaccgaaggcaaagttgccattgctgcaacacttgaagtcaaagatcccaccagaatagtcgatcctccacgtgatttgcgggttttggcgggaaccactattcagttttcatgccagccagagtttgatccctcttttggtgatgactttgaagtcctgtgggagaaagatggcattgccctcaacggcagcgaagatggaagatatatcctggaagacggagtgctggagatcattaatgtgagtttcggagaccagggcttttacgcgtgtgtggccagaacgcccgttgaccaagacgttgcagtggcacagctttcagtcgtggatgttcctgatccaccagaggatgtgatactgtctgaacataatggccgaagtgtgaaactgcagtggactccgggagatgaccataatagctccattaccgagtttgttctagagtttgaagaaagccaacatgagccaggcagctggagggagatgatgagagtcccaggaaaccatcactcagctccgctgaagctttatggacatgtggactaccgcttcagagtctccgccatcaacgaggtgggcaaaggtcggccaagccagtccactgaaagatacaaaactccagcatcagcacccgacaagaacccagaaaatatcaagatcgaagctcatttgccacatgaaatggatatcaactgggagccgttgtcacctattgaacacaacgggcctggtctggagtacaaagtgagctacaggagacatggcagcgatgaagactggacggagcgcatggtgaagaggcactcatttctggtcaaaaacaccccgacgttcgtcctttacgagatcaaaattcaggccaagaaccacgcgggctggggtccggaccctaaaataataacagcgtactcgggagaggatttcccctcagcagctccagatgatgtagccgtagaagtgttgaacaacactatggtgaaggtcagatgggaacatgttcacaaggacaaaatacatggacatctgggtggctacagggtgagctggtggaggcttcgtagtctgctggactcaaagaaaacacacggcgacaagcacacattgacattctcaggcgagaggaaccatgcggtggtcacaggtcttaagccgttctccgaatacagcctcattgtcatggcctttaacagcagaggaaacggtcctggcagtcattcggtcaacttcaaaacccctgagggagttcctggtcaagcagctgctttcagtgctacaaacatccagaagcacaaggtcaccttgacctggtctcctccagttgacgcaaatggagtcctaattggctacatcctccaatatcagctaataaacaacacagaggaactaggccctctgatgacactcaacatctccgccgacagcaataagcagcacctcgaaaacctggaagccctgagcaaatacaaattttaccttcggtgttgcacgcgggtgggctgcggtcctgcggtcagcgaggagcgcaccaccgtccctgaagccacttcaacagatgtggcctctttcaacatcagaaaatccagctcacgatttcctccaagaaaaaccactgtttcccctgtggctaatgctactctttcttctatagcggtgttgaatattagcacctcagttagtcacaactatgcaaatatcagctggattccaggcacagaacagacggagtcagagttatatgttgcctttatgaacaaccgtgaaggtaactggaagatatccgacatgctaaactcttctaagactttccacatcattgaagggctcgaacctggaaccgaatacacagtgcgtcttatgacaaaaagctgggttgataattctagtattttcgaagacgttatcaggaccagggccaaaggtctggccagcattcatggaagcatctcaaaccagggatggttcatcggactcatgtgtgccatagcgcttctcaccctcattgtgctcatagcgtgctttgtcaaccgaaacaaaggcggcaaatactcagtaaaagagaaggaagacctccaccccgacctggagtcccagggcataaatgatgacaccttctgtgaatacagtgataatgatgagaaaccgctgaaaagcagccagcattcattgaatggcgacttgaaaggaggagacagcggagacagcatggtggactactgtgatgaggacgctcacttcaacgaggacggctcttttatcggagaatactctggacgcaaggacagggcctccatggaaatcaagggaaacaatcagagcacagcgtaatggaccacggacaatttatttgttggacaagctctcacaaaaggtcagtcaaaaggaagcggagggaataaaagtgtggcgtaacagcacccgaaggacatttttgcaattaatgtgttattgtcaaatcctcagtcatactcacatcattttttacagggcttagttgtttccatttttttctgcgtgctgttactgatcaatcatgtcagttgtgtatacttttgtgaggtgtttttgtattaaatctttgcaaatcattgatgactgccgggaaagttctgctttcaacgtcatcatgtagccaagccagtttttctgtcagggtatatgaactttgtatttttatttttcattccaggcaaatattattgacattttatatttcagacactgtatactgtgcgttcattaaatgtgggttattatgtgtacaaaaggagttgttgcttaaataatcataagttctgttaaaatccaaaaaaaatgaaagaaagcgtaaggcgatgtaagggtttacaattagtgtaaaatgctttgatgaacagtttcacattgagctatactaacaagcttaatagccatattcagcaccacataaaccctacagtgcatctgctgctgttttaaccctttacatacagtataatacagtattttatcaaaaagacacctaatgttcatacatttaaagaaaaaaaaatgcctcaattgccttataatgactttgaatctggtaagtaagatataacaatggggtatgtgcacatggagttttaatttcagccagccagcctcagtgtttccggtgaactgtctttcctttataaaatcgccacgtttaagatctggtttcgttagaaatcagtgatcctcactgcctgatagatatacaatgtgaagagggtctcagatcgaaaaaagaagcactgcatttaatttcattttccctttccatgtctttaaaatatgtacaattaatttttgtattttcaattgagtttctgcattagcctgctgatactgatggcgtgtcacagatgttttcatactgcatgactatctagggtagcattctgttagtgatgtgtttacattttaggatggattggcgacagggggtttcacactgcatgactttacagtaggaagaatcgccgttgactttgtccaaactttgtctcacaatcaaacacacaagagaagtgacatggaaaaggatgtccgcgaggtcctaaaatgtattaaaagttgattaatcaattaagagaaaattaaagcttaaaaggtatttaaaaagtcttaatcacacttttacgaggttttataaattagctcaagcattgtccaaagtgtttgattccaaaaagtataatatatttatggctcgatccacgcgattggttcaggccggggtatgtccggccaagctcctccgttcgagtgatgtcacgtaatttgcaacaaatacgggaaggtgatgctctccacatgtagcgaaaccatagagcgaaacagacggcaaaatgagaaaatgtaagtactcctggttggagaaagacgagtttaaacagtagctgaagcctgtcgtttaaaacaaccacgtaatttattctttcaagctttgtttcttcttgagttctgttgcatgattatgctctattgatttaactacaacacgtagtgtatcttgggttatcaaccatatgcctttagtggggtagcaaatgtacttatttctcctcaacattttattctttatcgatccagttgtggtgttgctcagatgacatgtcaaacagatgcgtgtgctcctgccaaatttccatagttttcctccttttcttggatccaaataaactgagattgagcgcttttaacttctccctgctgatacccatactagcggatgcagctctctcattggctgcaggtaatcgcaaatgttattttcaatcagaacacatttcacacagcatgatttgaatcgccgacagacccaaatatttagcacgccaaatatctcaagggtgtcagcgactcatctgggattctctcagatcgcgtctttgatagttcatactgtgtgattgttactcacatgaatgagcaacgattcacttttgatttcaggcatttgtctgcgatttctcaaaacctgtcggcaaaaaatctgggctaaactcttgcagtctgaactcggcataagtctatttaactgaatgtatttgaattacattataacattgatgctgtaaaaggaacattatgaaactgagaatgtctggctggaaacactagctgtgcatataccccattctcatggattccgtgatacagggttggaattctacaaattccacattggcatcctttgaaatatttctcttcacaaacggacagttctgaaagccaacaagtcttgtttgaacaattctgtatgtttttttgcaatggctccacatatagagtcaaagccagattctgtacaatgttctgtgaattctgtttgcatgttgaaagaggtctgtgtgcagatttgacattaaattgtatcatttctttcttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]