2024-05-19 10:42:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017356689 6760 bp mRNA linear VRT 15-JUN-2017 DEFINITION PREDICTED: Danio rerio cell adhesion molecule L1-like b (chl1b), transcript variant X4, mRNA. ACCESSION XM_017356689 VERSION XM_017356689.2 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007117.7) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jun 15, 2017 this sequence version replaced XM_017356689.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Danio rerio Annotation Release 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6760 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="6" gene 1..6760 /gene="chl1b" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 ESTs, 13 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 27 samples with support for all annotated introns" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" CDS 352..4191 /gene="chl1b" /codon_start=1 /product="neural cell adhesion molecule L1-like protein isoform X3" /protein_id="XP_017212178.2" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" /translation="
MRLLRKTLLLLAACLNMSSRYQTNALEIPLDVLERMNMEQLPTITEYSPASLIAFPFEESFPVKCEATGNPEPEFRWTKNGQDFDPYQDTRLITLDDSGTFIIPNTGNLTEFQGIYRCFATNKLGTAMSEEIEFIIPNVPKFPKEIIDPIEVMEGQSVILECNPPTGIPPLQIYWMTISLQHIEQDERVSVGLNGNLYFSNTVETDSRRDYCCFAAFPRIRTIVQKTAMSMVVKSTNSLLERKPSLLAPTGMESHTRLVKGEDLQLECIAEGFPTPKVEWVKIGFNKLPERVVVESHGKLLTVEMVNEEDEGKYMCRAKNPHGEVVHHFHVTVEEPPEFEIEPQSQLVTIGADVLIKCVVKGNPQPTVGWRVNGRPLNEVPTSNRKILKDGTISIHNANPENSAVYQCEATNKHGTILANANIMIMNIQPLILTENNLQYMAVEGKSVVMHCKVFSSPASSITWSKADSANAVEGERFTVHQNGSLEIHNVMKEDMGEYSCFAQNTEGKVAIAATLEVKDPTRIVDPPRDLRVLAGTTIQFSCQPEFDPSFGDDFEVLWEKDGIALNGSEDGRYILEDGVLEIINVSFGDQGFYACVARTPVDQDVAVAQLSVVDVPDPPEDVILSEHNGRSVKLQWTPGDDHNSSITEFVLEFEESQHEPGSWREMMRVPGNHHSAPLKLYGHVDYRFRVSAINEVGKGRPSQSTERYKTPASAPDKNPENIKIEAHLPHEMDINWEPLSPIEHNGPGLEYKVSYRRHGSDEDWTERMVKRHSFLVKNTPTFVLYEIKIQAKNHAGWGPDPKIITAYSGEDFPSAAPDDVAVEVLNNTMVKVRWEHVHKDKIHGHLGGYRVSWWRLRSLLDSKKTHGDKHTLTFSGERNHAVVTGLKPFSEYSLIVMAFNSRGNGPGSHSVNFKTPEGVPGQAAAFSATNIQKHKVTLTWSPPVDANGVLIGYILQYQLINNTEELGPLMTLNISADSNKQHLENLEALSKYKFYLRCCTRVGCGPAVSEERTTVPEATSTDVASFNIRKSSSRFPPRKTTVSPVANATLSSIAVLNISTSVSHNYANISWIPGTEQTESELYVAFMNNREGNWKISDMLNSSKTFHIIEGLEPGTEYTVRLMTKSWVDNSSIFEDVIRTRAKGLASIHGSISNQGWFIGLMCAIALLTLIVLIACFVNRNKGGKYSVKEKEDLHPDLESQGINDDTFCEYSDNDEKPLKSSQHSLNGDLKGGDSGDSMVDYCDEDAHFNEDGSFIGEYSGRKDRASMEIKGNNQSTA"
misc_feature 475..756 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 532..546 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 571..585 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 646..660 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 694..711 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 736..747 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 781..1053 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 823..837 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 865..879 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 934..948 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 979..996 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1027..1038 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1105..1350 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1141..1155 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1180..1194 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1246..1260 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1288..1305 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1327..1338 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1381..1620 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1411..1425 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1450..1464 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1522..1536 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1564..1581 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1603..1614 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1645..1905 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1693..1707 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1732..1746 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1801..1815 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1843..1860 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1882..1893 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1909..2211 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1966..1980 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2017..2031 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2086..2100 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2128..2145 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2167..2178 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2200..2472 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(2200..2202,2398..2400,2443..2445) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(2446..2451,2455..2460) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 2506..2751 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature 2800..3099 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(3064..3069,3073..3078) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature order(3112..3114,3316..3318,3361..3363) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature 3130..3372 /gene="chl1b" /note="Fibronectin type III domain; Region: fn3; pfam00041" /db_xref="CDD:394996" misc_feature order(3364..3369,3373..3378) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 3514..3732 /gene="chl1b" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 3892..4143 /gene="chl1b" /note="Bravo-like intracellular region; Region: Bravo_FIGEY; pfam13882" /db_xref="CDD:433552" ORIGIN
aaagcgctcagatctggctttgtgggagtgattgtcactcgtttaatgagcttctttgccaggcgagaggctttggcaacatatgtctccccagtcgcctctctcgctctgttagtaccgggtctgctgtggtggacgtttctctggattttcttctctttctcaagcctgtgggattagacagagcagaaaaggaagggtttgtctgtatttctgaggacgagcggactagaatgaagcagattcctgtagcgagaccacagcctgggttggagtgagatgcactgactcctggcagactgcagatttccctgtcatcctccgctctcgcctctgaaactgtggccagtcatgcggttgttacggaaaaccctgcttcttttggctgcttgccttaatatgagcagcaggtatcaaactaacgccctggaaattccacttgatgttttagagcgcatgaacatggagcagctgcccacaattacagagtactctcctgcctcgctcatcgccttccctttcgaagagagcttccctgtgaagtgtgaggccacaggaaaccctgaaccagaattcaggtggacaaagaacggccaagactttgatccgtatcaggacaccagattgataacgttagatgattccggaacattcatcattcccaataccggaaatctcactgaattccagggcatttatcgctgttttgcaaccaacaaattggggacagccatgtcagaagaaattgagttcattattcctaatgtcccaaagttccccaaagagatcatcgatccgattgaggtgatggaaggtcagtcagtcattctagagtgcaatccacctacagggatccctccattgcaaatctactggatgacaataagtctacagcacatcgagcaggacgaaagagtgtcagtgggtctgaatggaaacctgtacttctcaaacaccgttgaaactgatagccgcagagactattgctgctttgctgccttccctcgcatccgaactatcgtccagaaaaccgctatgtccatggtggtcaaaagcacaaactccctgttggagaggaagcccagcctgttggcgcctacaggaatggagtcacatacacgcctggtgaaaggtgaagatcttcagttggagtgtatagcagagggattccccacgccaaaggtggaatgggttaaaataggcttcaacaagcttccagaaagggttgttgtggagagtcatgggaagctgctcactgttgagatggtgaatgaggaggatgaaggcaaatatatgtgcagagccaaaaatccccacggagaggtggtgcatcattttcatgtgacagtagaggagcctcctgagtttgagattgaacctcaaagccaactggtgacgattggagctgatgtattgatcaagtgtgtcgtgaaaggaaatcctcaacctactgtaggatggagagttaacgggcggccactgaacgaggtcccaacatccaacaggaagatcttgaaagatggcacaatttccatccacaatgcaaacccagaaaacagtgctgtttaccaatgcgaggcaaccaacaaacacggcaccatcctggccaatgccaacatcatgattatgaacatccagccgctgatcttaacagaaaacaatctgcaatatatggcggtggaggggaaaagtgtggtcatgcactgcaaggtcttcagctctccagcctccagcattacgtggagtaaagctgacagtgcaaatgcagtggaaggagaacggtttactgttcaccagaatggttcactggagatccataatgtgatgaaagaggacatgggagagtattcttgctttgcacaaaacaccgaaggcaaagttgccattgctgcaacacttgaagtcaaagatcccaccagaatagtcgatcctccacgtgatttgcgggttttggcgggaaccactattcagttttcatgccagccagagtttgatccctcttttggtgatgactttgaagtcctgtgggagaaagatggcattgccctcaacggcagcgaagatggaagatatatcctggaagacggagtgctggagatcattaatgtgagtttcggagaccagggcttttacgcgtgtgtggccagaacgcccgttgaccaagacgttgcagtggcacagctttcagtcgtggatgttcctgatccaccagaggatgtgatactgtctgaacataatggccgaagtgtgaaactgcagtggactccgggagatgaccataatagctccattaccgagtttgttctagagtttgaagaaagccaacatgagccaggcagctggagggagatgatgagagtcccaggaaaccatcactcagctccgctgaagctttatggacatgtggactaccgcttcagagtctccgccatcaacgaggtgggcaaaggtcggccaagccagtccactgaaagatacaaaactccagcatcagcacccgacaagaacccagaaaatatcaagatcgaagctcatttgccacatgaaatggatatcaactgggagccgttgtcacctattgaacacaacgggcctggtctggagtacaaagtgagctacaggagacatggcagcgatgaagactggacggagcgcatggtgaagaggcactcatttctggtcaaaaacaccccgacgttcgtcctttacgagatcaaaattcaggccaagaaccacgcgggctggggtccggaccctaaaataataacagcgtactcgggagaggatttcccctcagcagctccagatgatgtagccgtagaagtgttgaacaacactatggtgaaggtcagatgggaacatgttcacaaggacaaaatacatggacatctgggtggctacagggtgagctggtggaggcttcgtagtctgctggactcaaagaaaacacacggcgacaagcacacattgacattctcaggcgagaggaaccatgcggtggtcacaggtcttaagccgttctccgaatacagcctcattgtcatggcctttaacagcagaggaaacggtcctggcagtcattcggtcaacttcaaaacccctgagggagttcctggtcaagcagctgctttcagtgctacaaacatccagaagcacaaggtcaccttgacctggtctcctccagttgacgcaaatggagtcctaattggctacatcctccaatatcagctaataaacaacacagaggaactaggccctctgatgacactcaacatctccgccgacagcaataagcagcacctcgaaaacctggaagccctgagcaaatacaaattttaccttcggtgttgcacgcgggtgggctgcggtcctgcggtcagcgaggagcgcaccaccgtccctgaagccacttcaacagatgtggcctctttcaacatcagaaaatccagctcacgatttcctccaagaaaaaccactgtttcccctgtggctaatgctactctttcttctatagcggtgttgaatattagcacctcagttagtcacaactatgcaaatatcagctggattccaggcacagaacagacggagtcagagttatatgttgcctttatgaacaaccgtgaaggtaactggaagatatccgacatgctaaactcttctaagactttccacatcattgaagggctcgaacctggaaccgaatacacagtgcgtcttatgacaaaaagctgggttgataattctagtattttcgaagacgttatcaggaccagggccaaaggtctggccagcattcatggaagcatctcaaaccagggatggttcatcggactcatgtgtgccatagcgcttctcaccctcattgtgctcatagcgtgctttgtcaaccgaaacaaaggcggcaaatactcagtaaaagagaaggaagacctccaccccgacctggagtcccagggcataaatgatgacaccttctgtgaatacagtgataatgatgagaaaccgctgaaaagcagccagcattcattgaatggcgacttgaaaggaggagacagcggagacagcatggtggactactgtgatgaggacgctcacttcaacgaggacggctcttttatcggagaatactctggacgcaaggacagggcctccatggaaatcaagggaaacaatcagagcacagcgtaatggaccacggacaatttatttgttggacaagctctcacaaaaggtcagtcaaaaggaagcggagggaataaaagtgtggcgtaacagcacccgaaggacatttttgcaattaatgtgttattgtcaaatcctcagtcatactcacatcattttttacagggcttagttgtttccatttttttctgcgtgctgttactgatcaatcatgtcagttgtgtatacttttgtgaggtgtttttgtattaaatctttgcaaatcattgatgactgccgggaaagttctgctttcaacgtcatcatgtagccaagccagtttttctgtcagggtatatgaactttgtatttttatttttcattccaggcaaatattattgacattttatatttcagacactgtatactgtgcgttcattaaatgtgggttattatgtgtacaaaaggagttgttgcttaaataatcataagttctgttaaaatccaaaaaaaatgaaagaaagcgtaaggcgatgtaagggtttacaattagtgtaaaatgctttgatgaacagtttcacattgagctatactaacaagcttaatagccatattcagcaccacataaaccctacagtgcatctgctgctgttttaaccctttacatacagtataatacagtattttatcaaaaagacacctaatgttcatacatttaaagaaaaaaaaatgcctcaattgccttataatgactttgaatctggtaagtaagatataacaatggggtatgtgcacatggagttttaatttcagccagccagcctcagtgtttccggtgaactgtctttcctttataaaatcgccacgtttaagatctggtttcgttagaaatcagtgatcctcactgcctgatagatatacaatgtgaagagggtctcagatcgaaaaaagaagcactgcatttaatttcattttccctttccatgtctttaaaatatgtacaattaatttttgtattttcaattgagtttctgcattagcctgctgatactgatggcgtgtcacagatgttttcatactgcatgactatctagggtagcattctgttagtgatgtgtttacattttaggatggattggcgacagggggtttcacactgcatgactttacagtaggaagaatcgccgttgactttgtccaaactttgtctcacaatcaaacacacaagagaagtgacatggaaaaggatgtccgcgaggtcctaaaatgtattaaaagttgattaatcaattaagagaaaattaaagcttaaaaggtatttaaaaagtcttaatcacacttttacgaggttttataaattagctcaagcattgtccaaagtgtttgattccaaaaagtataatatatttatggctcgatccacgcgattggttcaggccggggtatgtccggccaagctcctccgttcgagtgatgtcacgtaatttgcaacaaatacgggaaggtgatgctctccacatgtagcgaaaccatagagcgaaacagacggcaaaatgagaaaatgtaagtactcctggttggagaaagacgagtttaaacagtagctgaagcctgtcgtttaaaacaaccacgtaatttattctttcaagctttgtttcttcttgagttctgttgcatgattatgctctattgatttaactacaacacgtagtgtatcttgggttatcaaccatatgcctttagtggggtagcaaatgtacttatttctcctcaacattttattctttatcgatccagttgtggtgttgctcagatgacatgtcaaacagatgcgtgtgctcctgccaaatttccatagttttcctccttttcttggatccaaataaactgagattgagcgcttttaacttctccctgctgatacccatactagcggatgcagctctctcattggctgcaggtaatcgcaaatgttattttcaatcagaacacatttcacacagcatgatttgaatcgccgacagacccaaatatttagcacgccaaatatctcaagggtgtcagcgactcatctgggattctctcagatcgcgtctttgatagttcatactgtgtgattgttactcacatgaatgagcaacgattcacttttgatttcaggcatttgtctgcgatttctcaaaacctgtcggcaaaaaatctgggctaaactcttgcagtctgaactcggcataagtctatttaactgaatgtatttgaattacattataacattgatgctgtaaaaggaacattatgaaactgagaatgtctggctggaaacactagctgtgcatataccccattctcatggattccgtgatacagggttggaattctacaaattccacattggcatcctttgaaatatttctcttcacaaacggacagttctgaaagccaacaagtcttgtttgaacaattctgtatgtttttttgcaatggctccacatatagagtcaaagccagattctgtacaatgttctgtgaattctgtttgcatgttgaaagaggtctgtgtgcagatttgacattaaattgtatcatttctttcttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]