2024-05-19 04:52:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017356687 6756 bp mRNA linear VRT 15-JUN-2017 DEFINITION PREDICTED: Danio rerio cell adhesion molecule L1-like b (chl1b), transcript variant X2, mRNA. ACCESSION XM_017356687 VERSION XM_017356687.2 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007117.7) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jun 15, 2017 this sequence version replaced XM_017356687.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Danio rerio Annotation Release 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6756 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="6" gene 1..6756 /gene="chl1b" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 12 ESTs, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 21 samples with support for all annotated introns" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" CDS 303..4187 /gene="chl1b" /codon_start=1 /product="neural cell adhesion molecule L1-like protein isoform X1" /protein_id="XP_017212176.2" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" /translation="
MRLLRKTLLLLAACLNMSSRYQTNALEIPLDVLERMNMEQLPTITEYSPASLIAFPFEESFPVKCEATGNPEPEFRWTKNGQDFDPYQDTRLITLDDSGTFIIPNTGNLTEFQGIYRCFATNKLGTAMSEEIEFIIPNVPKFPKEIIDPIEVMEGQSVILECNPPTGIPPLQIYWMTISLQHIEQDERVSVGLNGNLYFSNTVETDSRRDYCCFAAFPRIRTIVQKTAMSMVVKSNKLMKDSSSGSGRGYANSLLERKPSLLAPTGMESHTRLVKGEDLQLECIAEGFPTPKVEWVKIGFNKLPERVVVESHGKLLTVEMVNEEDEGKYMCRAKNPHGEVVHHFHVTVEEPPEFEIEPQSQLVTIGADVLIKCVVKGNPQPTVGWRVNGRPLNEVPTSNRKILKDGTISIHNANPENSAVYQCEATNKHGTILANANIMIMNIQPLILTENNLQYMAVEGKSVVMHCKVFSSPASSITWSKADSANAVEGERFTVHQNGSLEIHNVMKEDMGEYSCFAQNTEGKVAIAATLEVKDPTRIVDPPRDLRVLAGTTIQFSCQPEFDPSFGDDFEVLWEKDGIALNGSEDGRYILEDGVLEIINVSFGDQGFYACVARTPVDQDVAVAQLSVVDVPDPPEDVILSEHNGRSVKLQWTPGDDHNSSITEFVLEFEESQHEPGSWREMMRVPGNHHSAPLKLYGHVDYRFRVSAINEVGKGRPSQSTERYKTPASAPDKNPENIKIEAHLPHEMDINWEPLSPIEHNGPGLEYKVSYRRHGSDEDWTERMVKRHSFLVKNTPTFVLYEIKIQAKNHAGWGPDPKIITAYSGEDFPSAAPDDVAVEVLNNTMVKVRWEHVHKDKIHGHLGGYRVSWWRLRSLLDSKKTHGDKHTLTFSGERNHAVVTGLKPFSEYSLIVMAFNSRGNGPGSHSVNFKTPEGVPGQAAAFSATNIQKHKVTLTWSPPVDANGVLIGYILQYQLINNTEELGPLMTLNISADSNKQHLENLEALSKYKFYLRCCTRVGCGPAVSEERTTVPEATSTDVASFNIRKSSSRFPPRKTTVSPVANATLSSIAVLNISTSVSHNYANISWIPGTEQTESELYVAFMNNREGNWKISDMLNSSKTFHIIEGLEPGTEYTVRLMTKSWVDNSSIFEDVIRTRAKGLASIHGSISNQGWFIGLMCAIALLTLIVLIACFVNRNKGGKYSVKEKEDLHPDLESQGINDDTFCEYSDNDEKPLKSSQHSLNGDLKGGDSGDSMVDYCDEDAHFNEDGSFIGEYSGRKDRASMEIKGNNQSTA"
misc_feature 426..707 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 483..497 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 522..536 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 597..611 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 645..662 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 687..698 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 732..1004 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 774..788 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 816..830 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 885..899 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 930..947 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 978..989 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1101..1346 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1137..1151 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1176..1190 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1242..1256 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1284..1301 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1323..1334 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1377..1616 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1407..1421 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1446..1460 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1518..1532 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1560..1577 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1599..1610 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1641..1901 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1689..1703 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1728..1742 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1797..1811 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1839..1856 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1878..1889 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1905..2207 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1962..1976 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2013..2027 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2082..2096 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2124..2141 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2163..2174 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2196..2468 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(2196..2198,2394..2396,2439..2441) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(2442..2447,2451..2456) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 2502..2747 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature 2796..3095 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(3060..3065,3069..3074) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature order(3108..3110,3312..3314,3357..3359) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature 3126..3368 /gene="chl1b" /note="Fibronectin type III domain; Region: fn3; pfam00041" /db_xref="CDD:394996" misc_feature order(3360..3365,3369..3374) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 3510..3728 /gene="chl1b" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 3888..4139 /gene="chl1b" /note="Bravo-like intracellular region; Region: Bravo_FIGEY; pfam13882" /db_xref="CDD:433552" ORIGIN
gtcacaatgtagcgaagttgtggaggggttttctcggttgccatggatttctaaaagctattgactgcgttcagcctttcactgaacgtatttgtaagagaaacgcaccactgaagtaaaagcatcatcgctccagacattctgctgtcgcgcgctgactaacagctccagctcttcccgcaaaaaactcctgtgaaaggtagcgagaccacagcctgggttggagtgagatgcactgactcctggcagactgcagatttccctgtcatcctccgctctcgcctctgaaactgtggccagtcatgcggttgttacggaaaaccctgcttcttttggctgcttgccttaatatgagcagcaggtatcaaactaacgccctggaaattccacttgatgttttagagcgcatgaacatggagcagctgcccacaattacagagtactctcctgcctcgctcatcgccttccctttcgaagagagcttccctgtgaagtgtgaggccacaggaaaccctgaaccagaattcaggtggacaaagaacggccaagactttgatccgtatcaggacaccagattgataacgttagatgattccggaacattcatcattcccaataccggaaatctcactgaattccagggcatttatcgctgttttgcaaccaacaaattggggacagccatgtcagaagaaattgagttcattattcctaatgtcccaaagttccccaaagagatcatcgatccgattgaggtgatggaaggtcagtcagtcattctagagtgcaatccacctacagggatccctccattgcaaatctactggatgacaataagtctacagcacatcgagcaggacgaaagagtgtcagtgggtctgaatggaaacctgtacttctcaaacaccgttgaaactgatagccgcagagactattgctgctttgctgccttccctcgcatccgaactatcgtccagaaaaccgctatgtccatggtggtcaaaagcaacaagttaatgaaggactcaagctctggtagcggcagaggttatgcaaactccctgttggagaggaagcccagcctgttggcgcctacaggaatggagtcacatacacgcctggtgaaaggtgaagatcttcagttggagtgtatagcagagggattccccacgccaaaggtggaatgggttaaaataggcttcaacaagcttccagaaagggttgttgtggagagtcatgggaagctgctcactgttgagatggtgaatgaggaggatgaaggcaaatatatgtgcagagccaaaaatccccacggagaggtggtgcatcattttcatgtgacagtagaggagcctcctgagtttgagattgaacctcaaagccaactggtgacgattggagctgatgtattgatcaagtgtgtcgtgaaaggaaatcctcaacctactgtaggatggagagttaacgggcggccactgaacgaggtcccaacatccaacaggaagatcttgaaagatggcacaatttccatccacaatgcaaacccagaaaacagtgctgtttaccaatgcgaggcaaccaacaaacacggcaccatcctggccaatgccaacatcatgattatgaacatccagccgctgatcttaacagaaaacaatctgcaatatatggcggtggaggggaaaagtgtggtcatgcactgcaaggtcttcagctctccagcctccagcattacgtggagtaaagctgacagtgcaaatgcagtggaaggagaacggtttactgttcaccagaatggttcactggagatccataatgtgatgaaagaggacatgggagagtattcttgctttgcacaaaacaccgaaggcaaagttgccattgctgcaacacttgaagtcaaagatcccaccagaatagtcgatcctccacgtgatttgcgggttttggcgggaaccactattcagttttcatgccagccagagtttgatccctcttttggtgatgactttgaagtcctgtgggagaaagatggcattgccctcaacggcagcgaagatggaagatatatcctggaagacggagtgctggagatcattaatgtgagtttcggagaccagggcttttacgcgtgtgtggccagaacgcccgttgaccaagacgttgcagtggcacagctttcagtcgtggatgttcctgatccaccagaggatgtgatactgtctgaacataatggccgaagtgtgaaactgcagtggactccgggagatgaccataatagctccattaccgagtttgttctagagtttgaagaaagccaacatgagccaggcagctggagggagatgatgagagtcccaggaaaccatcactcagctccgctgaagctttatggacatgtggactaccgcttcagagtctccgccatcaacgaggtgggcaaaggtcggccaagccagtccactgaaagatacaaaactccagcatcagcacccgacaagaacccagaaaatatcaagatcgaagctcatttgccacatgaaatggatatcaactgggagccgttgtcacctattgaacacaacgggcctggtctggagtacaaagtgagctacaggagacatggcagcgatgaagactggacggagcgcatggtgaagaggcactcatttctggtcaaaaacaccccgacgttcgtcctttacgagatcaaaattcaggccaagaaccacgcgggctggggtccggaccctaaaataataacagcgtactcgggagaggatttcccctcagcagctccagatgatgtagccgtagaagtgttgaacaacactatggtgaaggtcagatgggaacatgttcacaaggacaaaatacatggacatctgggtggctacagggtgagctggtggaggcttcgtagtctgctggactcaaagaaaacacacggcgacaagcacacattgacattctcaggcgagaggaaccatgcggtggtcacaggtcttaagccgttctccgaatacagcctcattgtcatggcctttaacagcagaggaaacggtcctggcagtcattcggtcaacttcaaaacccctgagggagttcctggtcaagcagctgctttcagtgctacaaacatccagaagcacaaggtcaccttgacctggtctcctccagttgacgcaaatggagtcctaattggctacatcctccaatatcagctaataaacaacacagaggaactaggccctctgatgacactcaacatctccgccgacagcaataagcagcacctcgaaaacctggaagccctgagcaaatacaaattttaccttcggtgttgcacgcgggtgggctgcggtcctgcggtcagcgaggagcgcaccaccgtccctgaagccacttcaacagatgtggcctctttcaacatcagaaaatccagctcacgatttcctccaagaaaaaccactgtttcccctgtggctaatgctactctttcttctatagcggtgttgaatattagcacctcagttagtcacaactatgcaaatatcagctggattccaggcacagaacagacggagtcagagttatatgttgcctttatgaacaaccgtgaaggtaactggaagatatccgacatgctaaactcttctaagactttccacatcattgaagggctcgaacctggaaccgaatacacagtgcgtcttatgacaaaaagctgggttgataattctagtattttcgaagacgttatcaggaccagggccaaaggtctggccagcattcatggaagcatctcaaaccagggatggttcatcggactcatgtgtgccatagcgcttctcaccctcattgtgctcatagcgtgctttgtcaaccgaaacaaaggcggcaaatactcagtaaaagagaaggaagacctccaccccgacctggagtcccagggcataaatgatgacaccttctgtgaatacagtgataatgatgagaaaccgctgaaaagcagccagcattcattgaatggcgacttgaaaggaggagacagcggagacagcatggtggactactgtgatgaggacgctcacttcaacgaggacggctcttttatcggagaatactctggacgcaaggacagggcctccatggaaatcaagggaaacaatcagagcacagcgtaatggaccacggacaatttatttgttggacaagctctcacaaaaggtcagtcaaaaggaagcggagggaataaaagtgtggcgtaacagcacccgaaggacatttttgcaattaatgtgttattgtcaaatcctcagtcatactcacatcattttttacagggcttagttgtttccatttttttctgcgtgctgttactgatcaatcatgtcagttgtgtatacttttgtgaggtgtttttgtattaaatctttgcaaatcattgatgactgccgggaaagttctgctttcaacgtcatcatgtagccaagccagtttttctgtcagggtatatgaactttgtatttttatttttcattccaggcaaatattattgacattttatatttcagacactgtatactgtgcgttcattaaatgtgggttattatgtgtacaaaaggagttgttgcttaaataatcataagttctgttaaaatccaaaaaaaatgaaagaaagcgtaaggcgatgtaagggtttacaattagtgtaaaatgctttgatgaacagtttcacattgagctatactaacaagcttaatagccatattcagcaccacataaaccctacagtgcatctgctgctgttttaaccctttacatacagtataatacagtattttatcaaaaagacacctaatgttcatacatttaaagaaaaaaaaatgcctcaattgccttataatgactttgaatctggtaagtaagatataacaatggggtatgtgcacatggagttttaatttcagccagccagcctcagtgtttccggtgaactgtctttcctttataaaatcgccacgtttaagatctggtttcgttagaaatcagtgatcctcactgcctgatagatatacaatgtgaagagggtctcagatcgaaaaaagaagcactgcatttaatttcattttccctttccatgtctttaaaatatgtacaattaatttttgtattttcaattgagtttctgcattagcctgctgatactgatggcgtgtcacagatgttttcatactgcatgactatctagggtagcattctgttagtgatgtgtttacattttaggatggattggcgacagggggtttcacactgcatgactttacagtaggaagaatcgccgttgactttgtccaaactttgtctcacaatcaaacacacaagagaagtgacatggaaaaggatgtccgcgaggtcctaaaatgtattaaaagttgattaatcaattaagagaaaattaaagcttaaaaggtatttaaaaagtcttaatcacacttttacgaggttttataaattagctcaagcattgtccaaagtgtttgattccaaaaagtataatatatttatggctcgatccacgcgattggttcaggccggggtatgtccggccaagctcctccgttcgagtgatgtcacgtaatttgcaacaaatacgggaaggtgatgctctccacatgtagcgaaaccatagagcgaaacagacggcaaaatgagaaaatgtaagtactcctggttggagaaagacgagtttaaacagtagctgaagcctgtcgtttaaaacaaccacgtaatttattctttcaagctttgtttcttcttgagttctgttgcatgattatgctctattgatttaactacaacacgtagtgtatcttgggttatcaaccatatgcctttagtggggtagcaaatgtacttatttctcctcaacattttattctttatcgatccagttgtggtgttgctcagatgacatgtcaaacagatgcgtgtgctcctgccaaatttccatagttttcctccttttcttggatccaaataaactgagattgagcgcttttaacttctccctgctgatacccatactagcggatgcagctctctcattggctgcaggtaatcgcaaatgttattttcaatcagaacacatttcacacagcatgatttgaatcgccgacagacccaaatatttagcacgccaaatatctcaagggtgtcagcgactcatctgggattctctcagatcgcgtctttgatagttcatactgtgtgattgttactcacatgaatgagcaacgattcacttttgatttcaggcatttgtctgcgatttctcaaaacctgtcggcaaaaaatctgggctaaactcttgcagtctgaactcggcataagtctatttaactgaatgtatttgaattacattataacattgatgctgtaaaaggaacattatgaaactgagaatgtctggctggaaacactagctgtgcatataccccattctcatggattccgtgatacagggttggaattctacaaattccacattggcatcctttgaaatatttctcttcacaaacggacagttctgaaagccaacaagtcttgtttgaacaattctgtatgtttttttgcaatggctccacatatagagtcaaagccagattctgtacaatgttctgtgaattctgtttgcatgttgaaagaggtctgtgtgcagatttgacattaaattgtatcatttctttcttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]