GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-13 07:26:10, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_034220                 73 bp    RNA     linear   VRT 07-JUN-2025
DEFINITION  Danio rerio microRNA 430c-11 (dre-mir-430c-11), microRNA.
ACCESSION   NR_034220
VERSION     NR_034220.2
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 73)
  AUTHORS   Hadzhiev,Y., Wheatley,L., Cooper,L., Ansaloni,F., Whalley,C.,
            Chen,Z., Finaurini,S., Gustincich,S., Sanges,R., Burgess,S.,
            Beggs,A. and Muller,F.
  TITLE     The miR-430 locus with extreme promoter density forms a
            transcription body during the minor wave of zygotic genome
            activation
  JOURNAL   Dev Cell 58 (2), 155-170 (2023)
   PUBMED   36693321
REFERENCE   2  (bases 1 to 73)
  AUTHORS   Miao,L., Tang,Y., Bonneau,A.R., Chan,S.H., Kojima,M.L.,
            Pownall,M.E., Vejnar,C.E., Gao,F., Krishnaswamy,S., Hendry,C.E. and
            Giraldez,A.J.
  TITLE     The landscape of pioneer factor activity reveals the mechanisms of
            chromatin reprogramming and genome activation
  JOURNAL   Mol Cell 82 (5), 986-1002 (2022)
   PUBMED   35182480
REFERENCE   3  (bases 1 to 73)
  AUTHORS   D'Orazio,F.M., Balwierz,P.J., Gonzalez,A.J., Guo,Y.,
            Hernandez-Rodriguez,B., Wheatley,L., Jasiulewicz,A., Hadzhiev,Y.,
            Vaquerizas,J.M., Cairns,B., Lenhard,B. and Muller,F.
  TITLE     Germ cell differentiation requires Tdrd7-dependent chromatin and
            transcriptome reprogramming marked by germ plasm relocalization
  JOURNAL   Dev Cell 56 (5), 641-656 (2021)
   PUBMED   33651978
REFERENCE   4  (bases 1 to 73)
  AUTHORS   Chan,S.H., Tang,Y., Miao,L., Darwich-Codore,H., Vejnar,C.E.,
            Beaudoin,J.D., Musaev,D., Fernandez,J.P., Benitez,M.D.J.,
            Bazzini,A.A., Moreno-Mateos,M.A. and Giraldez,A.J.
  TITLE     Brd4 and P300 Confer Transcriptional Competency during Zygotic
            Genome Activation
  JOURNAL   Dev Cell 49 (6), 867-881 (2019)
   PUBMED   31211993
REFERENCE   5  (bases 1 to 73)
  AUTHORS   Hadzhiev,Y., Qureshi,H.K., Wheatley,L., Cooper,L., Jasiulewicz,A.,
            Van Nguyen,H., Wragg,J.W., Poovathumkadavil,D., Conic,S., Bajan,S.,
            Sik,A., Hutvagner,G., Tora,L., Gambus,A., Fossey,J.S. and Muller,F.
  TITLE     A cell cycle-coordinated Polymerase II transcription compartment
            encompasses gene expression before global genome activation
  JOURNAL   Nat Commun 10 (1), 691 (2019)
   PUBMED   30741925
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 73)
  AUTHORS   Liu,Y., Luo,D., Zhao,H., Zhu,Z., Hu,W. and Cheng,C.H.
  TITLE     Inheritable and precise large genomic deletions of non-coding RNA
            genes in zebrafish using TALENs
  JOURNAL   PLoS One 8 (10), e76387 (2013)
   PUBMED   24130773
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 73)
  AUTHORS   Cifuentes,D., Xue,H., Taylor,D.W., Patnode,H., Mishima,Y.,
            Cheloufi,S., Ma,E., Mane,S., Hannon,G.J., Lawson,N.D., Wolfe,S.A.
            and Giraldez,A.J.
  TITLE     A novel miRNA processing pathway independent of Dicer requires
            Argonaute2 catalytic activity
  JOURNAL   Science 328 (5986), 1694-1698 (2010)
   PUBMED   20448148
REFERENCE   8  (bases 1 to 73)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 73)
  AUTHORS   Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
            Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
            Zavolan,M. and Tuschl,T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
REFERENCE   10 (bases 1 to 73)
  AUTHORS   Giraldez,A.J., Cinalli,R.M., Glasner,M.E., Enright,A.J.,
            Thomson,J.M., Baskerville,S., Hammond,S.M., Bartel,D.P. and
            Schier,A.F.
  TITLE     MicroRNAs regulate brain morphogenesis in zebrafish
  JOURNAL   Science 308 (5723), 833-838 (2005)
   PUBMED   15774722
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JBMGRA010000004.1.
            
            On Apr 17, 2019 this sequence version replaced NR_034220.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR32588722.4172374.1,
                                        SRR32588729.33587756.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-73                JBMGRA010000004.1  31285739-31285811
FEATURES             Location/Qualifiers
     source          1..73
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="4"
                     /map="4"
     gene            1..73
                     /gene="dre-mir-430c-11"
                     /gene_synonym="mir430c-11"
                     /note="microRNA 430c-11"
                     /db_xref="GeneID:100033466"
                     /db_xref="miRBase:MI0002091"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-223"
     precursor_RNA   1..73
                     /gene="dre-mir-430c-11"
                     /gene_synonym="mir430c-11"
                     /product="microRNA 430c-11"
                     /db_xref="GeneID:100033466"
                     /db_xref="miRBase:MI0002091"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-223"
     exon            1..73
                     /gene="dre-mir-430c-11"
                     /gene_synonym="mir430c-11"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           9..29
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-430c-11"
                     /gene_synonym="mir430c-11"
                     /product="dre-miR-430c-5p"
                     /db_xref="miRBase:MIMAT0031929"
                     /db_xref="GeneID:100033466"
                     /db_xref="miRBase:MI0002091"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-223"
     ncRNA           45..66
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-430c-11"
                     /gene_synonym="mir430c-11"
                     /product="dre-miR-430c-3p"
                     /db_xref="miRBase:MIMAT0001425"
                     /db_xref="GeneID:100033466"
                     /db_xref="miRBase:MI0002091"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-223"
ORIGIN      
attaagatcacttcaaacaggagcattgatttgtcctttgttcataagtgcttctctttggggtagttttaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]