LOCUS       NR_034218                 73 bp    RNA     linear   VRT 01-AUG-2022
DEFINITION  Danio rerio microRNA 430c-9 (dre-mir-430c-9), microRNA.
ACCESSION   NR_034218
VERSION     NR_034218.2
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 73)
  AUTHORS   Chan SH, Tang Y, Miao L, Darwich-Codore H, Vejnar CE, Beaudoin JD,
            Musaev D, Fernandez JP, Benitez MDJ, Bazzini AA, Moreno-Mateos MA
            and Giraldez AJ.
  TITLE     Brd4 and P300 Confer Transcriptional Competency during Zygotic
            Genome Activation
  JOURNAL   Dev Cell 49 (6), 867-881 (2019)
   PUBMED   31211993
REFERENCE   2  (bases 1 to 73)
  AUTHORS   Hadzhiev Y, Qureshi HK, Wheatley L, Cooper L, Jasiulewicz A, Van
            Nguyen H, Wragg JW, Poovathumkadavil D, Conic S, Bajan S, Sik A,
            Hutvagner G, Tora L, Gambus A, Fossey JS and Muller F.
  TITLE     A cell cycle-coordinated Polymerase II transcription compartment
            encompasses gene expression before global genome activation
  JOURNAL   Nat Commun 10 (1), 691 (2019)
   PUBMED   30741925
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 73)
  AUTHORS   Liu Y, Luo D, Zhao H, Zhu Z, Hu W and Cheng CH.
  TITLE     Inheritable and precise large genomic deletions of non-coding RNA
            genes in zebrafish using TALENs
  JOURNAL   PLoS One 8 (10), e76387 (2013)
   PUBMED   24130773
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 73)
  AUTHORS   Cifuentes D, Xue H, Taylor DW, Patnode H, Mishima Y, Cheloufi S, Ma
            E, Mane S, Hannon GJ, Lawson ND, Wolfe SA and Giraldez AJ.
  TITLE     A novel miRNA processing pathway independent of Dicer requires
            Argonaute2 catalytic activity
  JOURNAL   Science 328 (5986), 1694-1698 (2010)
   PUBMED   20448148
REFERENCE   5  (bases 1 to 73)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   6  (bases 1 to 73)
  AUTHORS   Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan
            R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M and Tuschl T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
REFERENCE   7  (bases 1 to 73)
  AUTHORS   Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM,
            Baskerville S, Hammond SM, Bartel DP and Schier AF.
  TITLE     MicroRNAs regulate brain morphogenesis in zebrafish
  JOURNAL   Science 308 (5723), 833-838 (2005)
   PUBMED   15774722
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from BX088538.26.
            
            On Apr 17, 2019 this sequence version replaced NR_034218.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-73                BX088538.26        187406-187478       c
FEATURES             Location/Qualifiers
     source          1..73
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="4"
                     /map="4"
     gene            1..73
                     /gene="dre-mir-430c-9"
                     /gene_synonym="mir430c-9"
                     /note="microRNA 430c-9"
                     /db_xref="GeneID:100033464"
                     /db_xref="miRBase:MI0002089"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-221"
     precursor_RNA   1..73
                     /gene="dre-mir-430c-9"
                     /gene_synonym="mir430c-9"
                     /product="microRNA 430c-9"
                     /db_xref="GeneID:100033464"
                     /db_xref="miRBase:MI0002089"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-221"
     ncRNA           9..29
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-430c-9"
                     /gene_synonym="mir430c-9"
                     /product="dre-miR-430c-5p"
                     /db_xref="miRBase:MIMAT0031929"
                     /db_xref="GeneID:100033464"
                     /db_xref="miRBase:MI0002089"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-221"
     ncRNA           45..66
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-430c-9"
                     /gene_synonym="mir430c-9"
                     /product="dre-miR-430c-3p"
                     /db_xref="miRBase:MIMAT0001425"
                     /db_xref="GeneID:100033464"
                     /db_xref="miRBase:MI0002089"
                     /db_xref="ZFIN:ZDB-MIRNAG-090929-221"
ORIGIN      

attaagatcacttcaaacaggagcattgatttgtcctttgttcataagtgcttctctttggggtagttttaat

//