LOCUS       NR_029998                 87 bp    RNA     linear   VRT 02-DEC-2023
DEFINITION  Danio rerio microRNA 9-5 (mir9-5), microRNA.
ACCESSION   NR_029998
VERSION     NR_029998.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 87)
  AUTHORS   Soto X, Burton J, Manning CS, Minchington T, Lea R, Lee J, Kursawe
            J, Rattray M and Papalopulu N.
  TITLE     Sequential and additive expression of miR-9 precursors control
            timing of neurogenesis
  JOURNAL   Development 149 (19) (2022)
   PUBMED   36189829
REFERENCE   2  (bases 1 to 87)
  AUTHORS   Desvignes T, Sydes J, Montfort J, Bobe J and Postlethwait JH.
  TITLE     Evolution after Whole-Genome Duplication: Teleost MicroRNAs
  JOURNAL   Mol Biol Evol 38 (8), 3308-3331 (2021)
   PUBMED   33871629
REFERENCE   3  (bases 1 to 87)
  AUTHORS   Desvignes T, Batzel P, Sydes J, Eames BF and Postlethwait JH.
  TITLE     miRNA analysis with Prost! reveals evolutionary conservation of
            organ-enriched expression and post-transcriptional modifications in
            three-spined stickleback and zebrafish
  JOURNAL   Sci Rep 9 (1), 3913 (2019)
   PUBMED   30850632
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 87)
  AUTHORS   Madelaine R, Notwell JH, Skariah G, Halluin C, Chen CC, Bejerano G
            and Mourrain P.
  TITLE     A screen for deeply conserved non-coding GWAS SNPs uncovers a
            MIR-9-2 functional mutation associated to retinal vasculature
            defects in human
  JOURNAL   Nucleic Acids Res 46 (7), 3517-3531 (2018)
   PUBMED   29518216
REFERENCE   5  (bases 1 to 87)
  AUTHORS   Katz S, Cussigh D, Urban N, Blomfield I, Guillemot F, Bally-Cuif L
            and Coolen M.
  TITLE     A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
            Quiescent and Activated Neural Stem Cell States
  JOURNAL   Cell Rep 17 (5), 1383-1398 (2016)
   PUBMED   27783951
REFERENCE   6  (bases 1 to 87)
  AUTHORS   Kikuta H, Laplante M, Navratilova P, Komisarczuk AZ, Engstrom PG,
            Fredman D, Akalin A, Caccamo M, Sealy I, Howe K, Ghislain J,
            Pezeron G, Mourrain P, Ellingsen S, Oates AC, Thisse C, Thisse B,
            Foucher I, Adolf B, Geling A, Lenhard B and Becker TS.
  TITLE     Genomic regulatory blocks encompass multiple neighboring genes and
            maintain conserved synteny in vertebrates
  JOURNAL   Genome Res 17 (5), 545-555 (2007)
   PUBMED   17387144
REFERENCE   7  (bases 1 to 87)
  AUTHORS   Kapsimali M, Kloosterman WP, de Bruijn E, Rosa F, Plasterk RH and
            Wilson SW.
  TITLE     MicroRNAs show a wide diversity of expression profiles in the
            developing and mature central nervous system
  JOURNAL   Genome Biol 8 (8), R173 (2007)
   PUBMED   17711588
REFERENCE   8  (bases 1 to 87)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 87)
  AUTHORS   Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov
            E, de Bruijn E, Horvitz HR, Kauppinen S and Plasterk RH.
  TITLE     MicroRNA expression in zebrafish embryonic development
  JOURNAL   Science 309 (5732), 310-311 (2005)
   PUBMED   15919954
REFERENCE   10 (bases 1 to 87)
  AUTHORS   Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan
            R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M and Tuschl T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from BX465834.20.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609098.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-87                BX465834.20        130399-130485
FEATURES             Location/Qualifiers
     source          1..87
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="5"
                     /map="5"
     gene            1..87
                     /gene="mir9-5"
                     /gene_synonym="dre-mir-9-5"
                     /note="microRNA 9-5"
                     /db_xref="GeneID:100033557"
                     /db_xref="miRBase:MI0001884"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-2"
     precursor_RNA   1..87
                     /gene="mir9-5"
                     /gene_synonym="dre-mir-9-5"
                     /product="microRNA 9-5"
                     /db_xref="GeneID:100033557"
                     /db_xref="miRBase:MI0001884"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-2"
     exon            1..87
                     /gene="mir9-5"
                     /gene_synonym="dre-mir-9-5"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           16..38
                     /ncRNA_class="miRNA"
                     /gene="mir9-5"
                     /gene_synonym="dre-mir-9-5"
                     /product="dre-miR-9-5p"
                     /db_xref="miRBase:MIMAT0001769"
                     /db_xref="GeneID:100033557"
                     /db_xref="miRBase:MI0001884"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-2"
     ncRNA           54..74
                     /ncRNA_class="miRNA"
                     /gene="mir9-5"
                     /gene_synonym="dre-mir-9-5"
                     /product="dre-miR-9-3p"
                     /db_xref="miRBase:MIMAT0003156"
                     /db_xref="GeneID:100033557"
                     /db_xref="miRBase:MI0001884"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-2"
ORIGIN      

ggaagcgagttgttatctttggttatctagctgtatgagtattttgcacttcataaagctagataaccgaaagtaaaaactgcctcc

//