GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-28 10:39:33, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_029995                 87 bp    RNA     linear   VRT 07-JUN-2025
DEFINITION  Danio rerio microRNA 9-1 (dre-mir-9-1), microRNA.
ACCESSION   NR_029995
VERSION     NR_029995.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 87)
  AUTHORS   Soto,X., Burton,J., Manning,C.S., Minchington,T., Lea,R., Lee,J.,
            Kursawe,J., Rattray,M. and Papalopulu,N.
  TITLE     Sequential and additive expression of miR-9 precursors control
            timing of neurogenesis
  JOURNAL   Development 149 (19) (2022)
   PUBMED   36189829
REFERENCE   2  (bases 1 to 87)
  AUTHORS   Soto,X., Biga,V., Kursawe,J., Lea,R., Doostdar,P., Thomas,R. and
            Papalopulu,N.
  TITLE     Dynamic properties of noise and Her6 levels are optimized by miR-9,
            allowing the decoding of the Her6 oscillator
  JOURNAL   EMBO J 39 (12), e103558 (2020)
   PUBMED   32395844
  REMARK    GeneRIF: Dynamic properties of noise and Her6 levels are optimized
            by miR-9, allowing the decoding of the Her6 oscillator.
REFERENCE   3  (bases 1 to 87)
  AUTHORS   Madelaine,R., Sloan,S.A., Huber,N., Notwell,J.H., Leung,L.C.,
            Skariah,G., Halluin,C., Pasca,S.P., Bejerano,G., Krasnow,M.A.,
            Barres,B.A. and Mourrain,P.
  TITLE     MicroRNA-9 Couples Brain Neurogenesis and Angiogenesis
  JOURNAL   Cell Rep 20 (7), 1533-1542 (2017)
   PUBMED   28813666
  REMARK    GeneRIF: miR-9 modulation of neuronal VEGF-A controls brain
            angiogenesis in vivo.
REFERENCE   4  (bases 1 to 87)
  AUTHORS   Katz,S., Cussigh,D., Urban,N., Blomfield,I., Guillemot,F.,
            Bally-Cuif,L. and Coolen,M.
  TITLE     A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
            Quiescent and Activated Neural Stem Cell States
  JOURNAL   Cell Rep 17 (5), 1383-1398 (2016)
   PUBMED   27783951
  REMARK    GeneRIF: miR-9, along with Argonaute proteins (Agos), is localized
            to the nucleus of quiescent neural stem cells, and manipulating
            their nuclear/cytoplasmic ratio impacts quiescence.
REFERENCE   5  (bases 1 to 87)
  AUTHORS   King,B.L. and Yin,V.P.
  TITLE     A Conserved MicroRNA Regulatory Circuit Is Differentially
            Controlled during Limb/Appendage Regeneration
  JOURNAL   PLoS One 11 (6), e0157106 (2016)
   PUBMED   27355827
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 87)
  AUTHORS   Kikuta,H., Laplante,M., Navratilova,P., Komisarczuk,A.Z.,
            Engstrom,P.G., Fredman,D., Akalin,A., Caccamo,M., Sealy,I.,
            Howe,K., Ghislain,J., Pezeron,G., Mourrain,P., Ellingsen,S.,
            Oates,A.C., Thisse,C., Thisse,B., Foucher,I., Adolf,B., Geling,A.,
            Lenhard,B. and Becker,T.S.
  TITLE     Genomic regulatory blocks encompass multiple neighboring genes and
            maintain conserved synteny in vertebrates
  JOURNAL   Genome Res 17 (5), 545-555 (2007)
   PUBMED   17387144
REFERENCE   7  (bases 1 to 87)
  AUTHORS   Kapsimali,M., Kloosterman,W.P., de Bruijn,E., Rosa,F.,
            Plasterk,R.H. and Wilson,S.W.
  TITLE     MicroRNAs show a wide diversity of expression profiles in the
            developing and mature central nervous system
  JOURNAL   Genome Biol 8 (8), R173 (2007)
   PUBMED   17711588
REFERENCE   8  (bases 1 to 87)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 87)
  AUTHORS   Wienholds,E., Kloosterman,W.P., Miska,E., Alvarez-Saavedra,E.,
            Berezikov,E., de Bruijn,E., Horvitz,H.R., Kauppinen,S. and
            Plasterk,R.H.
  TITLE     MicroRNA expression in zebrafish embryonic development
  JOURNAL   Science 309 (5732), 310-311 (2005)
   PUBMED   15919954
REFERENCE   10 (bases 1 to 87)
  AUTHORS   Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
            Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
            Zavolan,M. and Tuschl,T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JBMGRA010000016.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609094.1, SRR32588730.13420459.1
                                        [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-87                JBMGRA010000016.1  32348382-32348468
FEATURES             Location/Qualifiers
     source          1..87
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="16"
                     /map="16"
     gene            1..87
                     /gene="dre-mir-9-1"
                     /gene_synonym="mir9-1"
                     /note="microRNA 9-1"
                     /db_xref="GeneID:100033553"
                     /db_xref="miRBase:MI0001880"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-1"
     precursor_RNA   1..87
                     /gene="dre-mir-9-1"
                     /gene_synonym="mir9-1"
                     /product="microRNA 9-1"
                     /db_xref="GeneID:100033553"
                     /db_xref="miRBase:MI0001880"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-1"
     exon            1..87
                     /gene="dre-mir-9-1"
                     /gene_synonym="mir9-1"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           15..37
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-9-1"
                     /gene_synonym="mir9-1"
                     /product="dre-miR-9-5p"
                     /db_xref="miRBase:MIMAT0001769"
                     /db_xref="GeneID:100033553"
                     /db_xref="miRBase:MI0001880"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-1"
     ncRNA           55..75
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-9-1"
                     /gene_synonym="mir9-1"
                     /product="dre-miR-9-3p"
                     /db_xref="miRBase:MIMAT0003156"
                     /db_xref="GeneID:100033553"
                     /db_xref="miRBase:MI0001880"
                     /db_xref="ZFIN:ZDB-MIRNAG-070720-1"
ORIGIN      
ggggttggctgttatctttggttatctagctgtatgagtgttattcattcttcataaagctagataaccgaaagtaacaagaatccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]