LOCUS       NR_023338                449 bp    RNA     linear   VRT 08-APR-2019
DEFINITION  Danio rerio trinucleotide repeat containing adaptor 6A (tnrc6a),
            non-coding RNA.
ACCESSION   NR_023338 XR_029030
VERSION     NR_023338.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 449)
  AUTHORS   Katz S, Cussigh D, Urban N, Blomfield I, Guillemot F, Bally-Cuif L
            and Coolen M.
  TITLE     A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
            Quiescent and Activated Neural Stem Cell States
  JOURNAL   Cell Rep 17 (5), 1383-1398 (2016)
   PUBMED   27783951
REFERENCE   2  (bases 1 to 449)
  AUTHORS   Elkon R, Milon B, Morrison L, Shah M, Vijayakumar S, Racherla M,
            Leitch CC, Silipino L, Hadi S, Weiss-Gayet M, Barras E, Schmid CD,
            Ait-Lounis A, Barnes A, Song Y, Eisenman DJ, Eliyahu E, Frolenkov
            GI, Strome SE, Durand B, Zaghloul NA, Jones SM, Reith W and
            Hertzano R.
  TITLE     RFX transcription factors are essential for hearing in mice
  JOURNAL   Nat Commun 6, 8549 (2015)
   PUBMED   26469318
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 449)
  AUTHORS   Makino S, Mishima Y, Inoue K and Inada T.
  TITLE     Roles of mRNA fate modulators Dhh1 and Pat1 in TNRC6-dependent gene
            silencing recapitulated in yeast
  JOURNAL   J. Biol. Chem. 290 (13), 8331-8347 (2015)
   PUBMED   25657010
  REMARK    GeneRIF: mRNA fate modulators are required for inhibition of
            translation by the tethered Mid domain of zebrafish TNRC6.
REFERENCE   4  (bases 1 to 449)
  AUTHORS   Mishima Y, Fukao A, Kishimoto T, Sakamoto H, Fujiwara T and Inoue
            K.
  TITLE     Translational inhibition by deadenylation-independent mechanisms is
            central to microRNA-mediated silencing in zebrafish
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 109 (4), 1104-1109 (2012)
   PUBMED   22232654
  REMARK    GeneRIF: TNRC6A Induces Translational Inhibition and Deadenylation
            Through the Mid Domain in Zebrafish Embryos.
REFERENCE   5  (bases 1 to 449)
  AUTHORS   Williams CM, Feng Y, Martin P and Poole AW.
  TITLE     Protein kinase C alpha and beta are positive regulators of thrombus
            formation in vivo in a zebrafish (Danio rerio) model of thrombosis
  JOURNAL   J. Thromb. Haemost. 9 (12), 2457-2465 (2011)
   PUBMED   21951302
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AI629260.1.
            
            On Jul 31, 2008 this sequence version replaced XR_029030.2.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AI629260.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-449               AI629260.1         1-449
FEATURES             Location/Qualifiers
     source          1..449
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:7955"
                     /chromosome="3"
                     /map="3"
     gene            1..449
                     /gene="tnrc6a"
                     /gene_synonym="wu:fc10d10"
                     /note="trinucleotide repeat containing adaptor 6A"
                     /pseudo
                     /db_xref="GeneID:571871"
                     /db_xref="ZFIN:ZDB-GENE-030131-2519"
     misc_RNA        1..449
                     /gene="tnrc6a"
                     /gene_synonym="wu:fc10d10"
                     /product="trinucleotide repeat containing adaptor 6A"
                     /pseudo
                     /db_xref="GeneID:571871"
                     /db_xref="ZFIN:ZDB-GENE-030131-2519"
ORIGIN      

ccacgcgtccgtataaatggcttgcctctgtactttttgccaaggaaggatggattagaggtgaatgtaatctattgttggtagtttaaataacttgcgttgattgacctttttattatactatattttaggtgcacaatttatgacgcttcaagagcgagagggagagaaagatgtcagcattaggctaagccatggaccttaatacgtgtttaagctgtttttgttgttgttgttgatgtttttcctccattcttttatttgcgaagaaggacttgcgtgatgtgttaacttatccatatttaatgactcatcgtacaaaaccctgagtattacccttcacttgatggttgcgtgccagtattgaaccattttaagtaaccgctttaccaaatatacttcaatcaaagcatatgtttacttaattccaggcctggcttatctcattg

//