2025-10-14 04:50:32, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_023338 449 bp RNA linear VRT 08-APR-2019 DEFINITION Danio rerio trinucleotide repeat containing adaptor 6A (tnrc6a), non-coding RNA. ACCESSION NR_023338 XR_029030 VERSION NR_023338.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 449) AUTHORS Katz S, Cussigh D, Urban N, Blomfield I, Guillemot F, Bally-Cuif L and Coolen M. TITLE A Nuclear Role for miR-9 and Argonaute Proteins in Balancing Quiescent and Activated Neural Stem Cell States JOURNAL Cell Rep 17 (5), 1383-1398 (2016) PUBMED 27783951 REFERENCE 2 (bases 1 to 449) AUTHORS Elkon R, Milon B, Morrison L, Shah M, Vijayakumar S, Racherla M, Leitch CC, Silipino L, Hadi S, Weiss-Gayet M, Barras E, Schmid CD, Ait-Lounis A, Barnes A, Song Y, Eisenman DJ, Eliyahu E, Frolenkov GI, Strome SE, Durand B, Zaghloul NA, Jones SM, Reith W and Hertzano R. TITLE RFX transcription factors are essential for hearing in mice JOURNAL Nat Commun 6, 8549 (2015) PUBMED 26469318 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 449) AUTHORS Makino S, Mishima Y, Inoue K and Inada T. TITLE Roles of mRNA fate modulators Dhh1 and Pat1 in TNRC6-dependent gene silencing recapitulated in yeast JOURNAL J. Biol. Chem. 290 (13), 8331-8347 (2015) PUBMED 25657010 REMARK GeneRIF: mRNA fate modulators are required for inhibition of translation by the tethered Mid domain of zebrafish TNRC6. REFERENCE 4 (bases 1 to 449) AUTHORS Mishima Y, Fukao A, Kishimoto T, Sakamoto H, Fujiwara T and Inoue K. TITLE Translational inhibition by deadenylation-independent mechanisms is central to microRNA-mediated silencing in zebrafish JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (4), 1104-1109 (2012) PUBMED 22232654 REMARK GeneRIF: TNRC6A Induces Translational Inhibition and Deadenylation Through the Mid Domain in Zebrafish Embryos. REFERENCE 5 (bases 1 to 449) AUTHORS Williams CM, Feng Y, Martin P and Poole AW. TITLE Protein kinase C alpha and beta are positive regulators of thrombus formation in vivo in a zebrafish (Danio rerio) model of thrombosis JOURNAL J. Thromb. Haemost. 9 (12), 2457-2465 (2011) PUBMED 21951302 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AI629260.1. On Jul 31, 2008 this sequence version replaced XR_029030.2. ##Evidence-Data-START## Transcript is intronless :: AI629260.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-449 AI629260.1 1-449 FEATURES Location/Qualifiers source 1..449 /organism="Danio rerio" /mol_type="transcribed RNA" /db_xref="taxon:7955" /chromosome="3" /map="3" gene 1..449 /gene="tnrc6a" /gene_synonym="wu:fc10d10" /note="trinucleotide repeat containing adaptor 6A" /pseudo /db_xref="GeneID:571871" /db_xref="ZFIN:ZDB-GENE-030131-2519" misc_RNA 1..449 /gene="tnrc6a" /gene_synonym="wu:fc10d10" /product="trinucleotide repeat containing adaptor 6A" /pseudo /db_xref="GeneID:571871" /db_xref="ZFIN:ZDB-GENE-030131-2519" ORIGIN
ccacgcgtccgtataaatggcttgcctctgtactttttgccaaggaaggatggattagaggtgaatgtaatctattgttggtagtttaaataacttgcgttgattgacctttttattatactatattttaggtgcacaatttatgacgcttcaagagcgagagggagagaaagatgtcagcattaggctaagccatggaccttaatacgtgtttaagctgtttttgttgttgttgttgatgtttttcctccattcttttatttgcgaagaaggacttgcgtgatgtgttaacttatccatatttaatgactcatcgtacaaaaccctgagtattacccttcacttgatggttgcgtgccagtattgaaccattttaagtaaccgctttaccaaatatacttcaatcaaagcatatgtttacttaattccaggcctggcttatctcattg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]