2024-05-06 06:03:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_214727 848 bp mRNA linear VRT 02-SEP-2023 DEFINITION Danio rerio brain-specific homeobox (bsx), mRNA. ACCESSION NM_214727 XM_687721 VERSION NM_214727.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 848) AUTHORS Carstensen MB, Medvetzky A, Weinberger A, Driever W, Gothilf Y and Rath MF. TITLE Genetic ablation of the Bsx homeodomain transcription factor in zebrafish: Impact on mature pineal gland morphology and circadian behavior JOURNAL J Pineal Res 72 (4), e12795 (2022) PUBMED 35249239 REFERENCE 2 (bases 1 to 848) AUTHORS Choi JH, Duboue ER, Macurak M, Chanchu JM and Halpern ME. TITLE Specialized neurons in the right habenula mediate response to aversive olfactory cues JOURNAL Elife 10, e72345 (2021) PUBMED 34878403 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 848) AUTHORS Schredelseker T, Veit F, Dorsky RI and Driever W. TITLE Bsx Is Essential for Differentiation of Multiple Neuromodulatory Cell Populations in the Secondary Prosencephalon JOURNAL Front Neurosci 14, 525 (2020) PUBMED 32581684 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 848) AUTHORS Schredelseker T and Driever W. TITLE Conserved Genoarchitecture of the Basal Hypothalamus in Zebrafish Embryos JOURNAL Front Neuroanat 14, 3 (2020) PUBMED 32116574 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 848) AUTHORS Mano H, Asaoka Y, Kojima D and Fukada Y. TITLE Brain-specific homeobox Bsx specifies identity of pineal gland between serially homologous photoreceptive organs in zebrafish JOURNAL Commun Biol 2, 364 (2019) PUBMED 31602413 REMARK GeneRIF: Bsx knock-down impaired the pineal development with reduced expression of exorh, the pineal-specific gene responsible for the photoreception, whereas it induced ectopic expression of rho, a retina-specific gene, in the pineal gland. Bsx remarkably transactivated the exorh promoter in combination with Otx5, but not with Crx, through its binding to distinct subtypes of PIRE. Publication Status: Online-Only REFERENCE 6 (bases 1 to 848) AUTHORS Schredelseker T and Driever W. TITLE Bsx controls pineal complex development JOURNAL Development 145 (13) (2018) PUBMED 29945867 REMARK GeneRIF: Bsx has a pivotal role in the differentiation of multiple cell types in the zebrafish pineal complex. Publication Status: Online-Only REFERENCE 7 (bases 1 to 848) AUTHORS Xie Y, Kaufmann D, Moulton MJ, Panahi S, Gaynes JA, Watters HN, Zhou D, Xue HH, Fung CM, Levine EM, Letsou A, Brennan KC and Dorsky RI. TITLE Lef1-dependent hypothalamic neurogenesis inhibits anxiety JOURNAL PLoS Biol 15 (8), e2002257 (2017) PUBMED 28837622 REMARK Publication Status: Online-Only REFERENCE 8 (bases 1 to 848) AUTHORS Kok FO, Taibi A, Wanner SJ, Xie X, Moravec CE, Love CE, Prince VE, Mumm JS and Sirotkin HI. TITLE Zebrafish rest regulates developmental gene expression but not neurogenesis JOURNAL Development 139 (20), 3838-3848 (2012) PUBMED 22951640 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AY515251.1. On Jan 26, 2008 this sequence version replaced XM_687721.2. ##Evidence-Data-START## Transcript exon combination :: AY515251.1, EH579801.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2168447, SAMEA3505370 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..848 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="10" /map="10" gene 1..848 /gene="bsx" /note="brain-specific homeobox" /db_xref="GeneID:573364" /db_xref="ZFIN:ZDB-GENE-040628-4" exon 1..337 /gene="bsx" /inference="alignment:Splign:2.1.0" misc_feature 13..15 /gene="bsx" /note="upstream in-frame stop codon" CDS 85..768 /gene="bsx" /note="brain-specific homeodomain protein" /codon_start=1 /product="brain-specific homeobox protein homolog" /protein_id="NP_999892.1" /db_xref="GeneID:573364" /db_xref="ZFIN:ZDB-GENE-040628-4" /translation="
MNLNYTSPVPQMPTQRSTSFFIEDILLHKPKPLREVFPSPFSNSIASRMPLLEYGYPLMPTPILAPHPHHPLHKPEHHPYFFTSGMQMPALFQHHPELPGKHCRRRKARTVFSDSQLSGLEKRFEIQRYLSTPERVELATALSLSETQVKTWFQNRRMKHKKQLRKTQDDQKTPNDVDRSLENTSESEMHEKNTDGKNGMSPDRYTLDDNEDDVDIEDDICSPEHLL"
misc_feature order(400..414,418..420,469..471,487..489,526..528, 532..537,544..549,553..561,565..570) /gene="bsx" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(406..408,415..417,535..537,544..549,556..558) /gene="bsx" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 409..567 /gene="bsx" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature 553..765 /gene="bsx" /note="propagated from UniProtKB/Swiss-Prot (Q6R3Q6.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 338..528 /gene="bsx" /inference="alignment:Splign:2.1.0" exon 529..848 /gene="bsx" /inference="alignment:Splign:2.1.0" ORIGIN
gaccgaccagagtgattttgtttgcgacgcaggcatcaaaagacgcacggattgttcgcccgagtgtttcaaaaaagttttgagatgaatctgaactacacgtctccggtgccccagatgccgactcaaaggtcaacgtcgttcttcattgaagatattttactacataaacctaaacctttgcgggaggtgtttccctcgcctttttcgaactctattgcctcccggatgcctcttttagagtatggatatccccttatgcctacaccgatactggctcctcatccgcatcatccgttacacaaacctgaacaccatccgtactttttcacctctggaatgcagatgccagcgttatttcagcatcatccggaattaccaggaaagcattgcagacgcagaaaggccagaacagtgttctcagactcacagttatccggactcgagaaaaggttcgagatccagagatatttgtccacacctgagcgcgtggaactggctacagctctcagtctatcggaaacacaggtaaagacgtggtttcaaaaccggaggatgaagcataaaaaacagctgaggaaaacacaagacgaccagaaaaccccgaatgatgtagacagatcgctggagaacacgagcgaaagcgaaatgcacgagaaaaacacagacggtaaaaacggcatgagcccggacagatacacgctggacgacaatgaagatgatgtcgatattgaagatgacatttgctctcctgaacatttactctagtagctattattacactacatcaacaaaaaatgtacatatgaatacaatcttttagataggaaattatatatagttttttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]