2024-05-06 06:39:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_131544 948 bp mRNA linear VRT 13-MAY-2023 DEFINITION Danio rerio homeobox A11a (hoxa11a), mRNA. ACCESSION NM_131544 VERSION NM_131544.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 948) AUTHORS Banu S, Gaur N, Nair S, Ravikrishnan T, Khan S, Mani S, Bharathi S, Mandal K, Kuram NA, Vuppaladadium S, Ravi R, Murthy CLN, Quoseena M, Babu NS and Idris MM. TITLE Understanding the complexity of epimorphic regeneration in zebrafish caudal fin tissue: A transcriptomic and proteomic approach JOURNAL Genomics 114 (2), 110300 (2022) PUBMED 35134499 REFERENCE 2 (bases 1 to 948) AUTHORS Yamada K, Maeno A, Araki S, Kikuchi M, Suzuki M, Ishizaka M, Satoh K, Akama K, Kawabe Y, Suzuki K, Kobayashi D, Hamano N and Kawamura A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 3 (bases 1 to 948) AUTHORS Hawkins MB, Henke K and Harris MP. TITLE Latent developmental potential to form limb-like skeletal structures in zebrafish JOURNAL Cell 184 (4), 899-911 (2021) PUBMED 33545089 REFERENCE 4 (bases 1 to 948) AUTHORS Zuccarini G, D'Atri I, Cottone E, Mackie K, Shainer I, Gothilf Y, Provero P, Bovolin P and Merlo GR. TITLE Interference with the Cannabinoid Receptor CB1R Results in Miswiring of GnRH3 and AgRP1 Axons in Zebrafish Embryos JOURNAL Int J Mol Sci 21 (1), 168 (2019) PUBMED 31881740 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 948) AUTHORS Langellotto F, Fiorentino M, De Felice E, Caputi L, Nittoli V, Joss JMP and Sordino P. TITLE Expression of meis and hoxa11 in dipnoan and teleost fins provides new insights into the evolution of vertebrate appendages JOURNAL Evodevo 9, 11 (2018) PUBMED 29719716 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 948) AUTHORS Santini S and Bernardi G. TITLE Organization and base composition of tilapia Hox genes: implications for the evolution of Hox clusters in fish JOURNAL Gene 346, 51-61 (2005) PUBMED 15716008 REFERENCE 7 (bases 1 to 948) AUTHORS Chiu CH, Dewar K, Wagner GP, Takahashi K, Ruddle F, Ledje C, Bartsch P, Scemama JL, Stellwag E, Fried C, Prohaska SJ, Stadler PF and Amemiya CT. TITLE Bichir HoxA cluster sequence reveals surprising trends in ray-finned fish genomic evolution JOURNAL Genome Res 14 (1), 11-17 (2004) PUBMED 14707166 REFERENCE 8 (bases 1 to 948) AUTHORS Amores A, Suzuki T, Yan YL, Pomeroy J, Singer A, Amemiya C and Postlethwait JH. TITLE Developmental roles of pufferfish Hox clusters and genome evolution in ray-fin fish JOURNAL Genome Res 14 (1), 1-10 (2004) PUBMED 14707165 REFERENCE 9 (bases 1 to 948) AUTHORS Lavoie H, Debeane F, Trinh QD, Turcotte JF, Corbeil-Girard LP, Dicaire MJ, Saint-Denis A, Page M, Rouleau GA and Brais B. TITLE Polymorphism, shared functions and convergent evolution of genes with sequences coding for polyalanine domains JOURNAL Hum Mol Genet 12 (22), 2967-2979 (2003) PUBMED 14519685 REFERENCE 10 (bases 1 to 948) AUTHORS Chiu CH, Amemiya C, Dewar K, Kim CB, Ruddle FH and Wagner GP. TITLE Molecular evolution of the HoxA cluster in the three major gnathostome lineages JOURNAL Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002) PUBMED 11943847 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF071240.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. FEATURES Location/Qualifiers source 1..948 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="19" /map="19" gene 1..948 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="homeobox A11a" /db_xref="GeneID:58061" /db_xref="ZFIN:ZDB-GENE-000823-8" CDS 1..948 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="homeo box A11a" /codon_start=1 /product="homeobox protein Hox-A11a" /protein_id="NP_571619.1" /db_xref="GeneID:58061" /db_xref="ZFIN:ZDB-GENE-000823-8" /translation="
MMDFDERVSVGSNMYLPSCTYYVPGADFSTLPSFLSQSPSTRPVTYSYASNLPQVQHVREVTFRDYAIDPSTKWPHRGPLAHCYPSEDSVHKECLPAVTTVGEMFPKNNASAYYHSTSNTTSASNFYGNVGRNGVLPQAFDQFFDTAYGGSDSVVDNDYAARDKMHSSKQSTPAPAPEQQPEGKERPETSSPESSSGNNEEKTSGANSKYELNKTVMRESLQCCALLLKFYMLFYKRIGGPRFRKKRCPYTKFQIRELEREFFFSVYINKEKRLQLSRMLNLTDRQVKMWFQNRRMKEKKLNRDRLQYYSTNPLL"
misc_feature 76..459 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="Protein of unknown function (DUF3528); Region: DUF3528; pfam12045" /db_xref="CDD:432284" misc_feature order(730..744,748..750,799..801,817..819,856..858, 862..867,874..879,883..891,895..900) /gene="hoxa11a" /gene_synonym="sb:eu415" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 736..897 /gene="hoxa11a" /gene_synonym="sb:eu415" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(736..738,745..747,865..867,874..879,886..888) /gene="hoxa11a" /gene_synonym="sb:eu415" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 1..712 /gene="hoxa11a" /gene_synonym="sb:eu415" /inference="alignment:Splign:2.1.0" exon 713..948 /gene="hoxa11a" /gene_synonym="sb:eu415" /inference="alignment:Splign:2.1.0" ORIGIN
atgatggattttgacgaaagggtttccgttggctccaacatgtatctgcccagctgcacatattacgttccgggggctgatttttccacgttgccctcttttctatcccaaagcccgtctactcgcccagtcacttactcttacgcttccaacctgcctcaggtacagcatgtcagggaggttacattccgggactatgctattgacccgtccaccaaatggcctcaccggggtccactggcacattgttatccgtcggaggattcagtccacaaggagtgtttaccagctgtaacgactgttggagaaatgttccctaagaataatgcatctgcgtattatcattctacatcgaacacgacatctgcgtccaatttttacggcaacgttggaagaaacggtgtgcttcctcaagcatttgaccagttttttgacaccgcctacggaggctcggacagtgtagtagacaacgactatgcagcaagggataaaatgcactccagcaaacagtcgacaccagcgcccgcaccggagcagcagcccgaaggaaaggagcgaccggagaccagtagccccgaatcatcttccggaaacaatgaggaaaaaactagcggtgcgaacagtaagtacgagctcaacaagactgtcatgcgagagagtttgcaatgttgcgcgctcctgttaaaattttatatgctgttttataagcgtataggtgggcccaggtttcgtaagaagaggtgtccctacactaaatttcaaattcgggagcttgaaagggaattcttcttcagcgtgtacatcaacaaagaaaaacgacttcagctctcacggatgcttaacctcactgatcgccaagtgaaaatgtggttccagaaccggcgcatgaaggaaaaaaaactaaatcgggacaggttacagtattacagtaccaatccactgctatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]