LOCUS       NM_131144               1020 bp    mRNA    linear   VRT 13-MAY-2023
DEFINITION  Danio rerio homeobox C5a (hoxc5a), mRNA.
ACCESSION   NM_131144
VERSION     NM_131144.2
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1020)
  AUTHORS   Banu S, Gaur N, Nair S, Ravikrishnan T, Khan S, Mani S, Bharathi S,
            Mandal K, Kuram NA, Vuppaladadium S, Ravi R, Murthy CLN, Quoseena
            M, Babu NS and Idris MM.
  TITLE     Understanding the complexity of epimorphic regeneration in
            zebrafish caudal fin tissue: A transcriptomic and proteomic
            approach
  JOURNAL   Genomics 114 (2), 110300 (2022)
   PUBMED   35134499
REFERENCE   2  (bases 1 to 1020)
  AUTHORS   Yamada K, Maeno A, Araki S, Kikuchi M, Suzuki M, Ishizaka M, Satoh
            K, Akama K, Kawabe Y, Suzuki K, Kobayashi D, Hamano N and Kawamura
            A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   3  (bases 1 to 1020)
  AUTHORS   Pillay S, Takahashi H, Carninci P and Kanhere A.
  TITLE     Antisense RNAs during early vertebrate development are divided in
            groups with distinct features
  JOURNAL   Genome Res 31 (6), 995-1010 (2021)
   PUBMED   33795334
REFERENCE   4  (bases 1 to 1020)
  AUTHORS   Malmstrom M, Britz R, Matschiner M, Torresen OK, Hadiaty RK, Yaakob
            N, Tan HH, Jakobsen KS, Salzburger W and Ruber L.
  TITLE     The Most Developmentally Truncated Fishes Show Extensive Hox Gene
            Loss and Miniaturized Genomes
  JOURNAL   Genome Biol Evol 10 (4), 1088-1103 (2018)
   PUBMED   29684203
REFERENCE   5  (bases 1 to 1020)
  AUTHORS   Barsh GR, Isabella AJ and Moens CB.
  TITLE     Vagus Motor Neuron Topographic Map Determined by Parallel
            Mechanisms of hox5 Expression and Time of Axon Initiation
  JOURNAL   Curr Biol 27 (24), 3812-3825 (2017)
   PUBMED   29225029
REFERENCE   6  (bases 1 to 1020)
  AUTHORS   Snell EA, Scemama JL and Stellwag EJ.
  TITLE     Genomic organization of the Hoxa4-Hoxa10 region from Morone
            saxatilis: implications for Hox gene evolution among vertebrates
  JOURNAL   J Exp Zool 285 (1), 41-49 (1999)
   PUBMED   10327649
REFERENCE   7  (bases 1 to 1020)
  AUTHORS   Gates MA, Kim L, Egan ES, Cardozo T, Sirotkin HI, Dougan ST,
            Lashkari D, Abagyan R, Schier AF and Talbot WS.
  TITLE     A genetic linkage map for zebrafish: comparative analysis and
            localization of genes and expressed sequences
  JOURNAL   Genome Res 9 (4), 334-347 (1999)
   PUBMED   10207156
REFERENCE   8  (bases 1 to 1020)
  AUTHORS   Prince VE, Joly L, Ekker M and Ho RK.
  TITLE     Zebrafish hox genes: genomic organization and modified colinear
            expression patterns in the trunk
  JOURNAL   Development 125 (3), 407-420 (1998)
   PUBMED   9425136
REFERENCE   9  (bases 1 to 1020)
  AUTHORS   Ekker M, Speevak MD, Martin CC, Joly L, Giroux G and Chevrette M.
  TITLE     Stable transfer of zebrafish chromosome segments into mouse cells
  JOURNAL   Genomics 33 (1), 57-64 (1996)
   PUBMED   8617510
REFERENCE   10 (bases 1 to 1020)
  AUTHORS   Geada AM, Coletta PL and Sharpe PT.
  TITLE     Characterization of the murine Hoxc-5 gene
  JOURNAL   Mamm Genome 7 (1), 81-84 (1996)
   PUBMED   8903739
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BX005254.9.
            
            On Aug 27, 2015 this sequence version replaced NM_131144.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC163205.1, GFIL01012817.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505371
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-551               BX005254.9         94968-95518         c
            552-1020            BX005254.9         93681-94149         c
FEATURES             Location/Qualifiers
     source          1..1020
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="23"
                     /map="23"
     gene            1..1020
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="homeobox C5a"
                     /db_xref="GeneID:30379"
                     /db_xref="ZFIN:ZDB-GENE-980526-533"
     exon            1..551
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    44..46
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="upstream in-frame stop codon"
     CDS             65..766
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="homeobox gene C-5; homeo box C5a"
                     /codon_start=1
                     /product="homeobox protein Hox-C5a"
                     /protein_id="NP_571219.2"
                     /db_xref="GeneID:30379"
                     /db_xref="ZFIN:ZDB-GENE-980526-533"
                     /translation="

MSSYVGKSFSKQTQDASSCRMHTFDNYGAHSEFHESNYAYEGLDLGGSFSSQIPTNSLRREAINTTDRARSSAAVQRTQSCSALGSRSFVSTHGYNPLSHGLLSQKAEGNMEVMEKPSGKSRTDDIKMETTSAIKQQTNSTQRQNQSQPQIYPWMTKLHMSHESDGKRSRTSYTRYQTLELEKEFHFNRYLTRRRRIEIANNLCLNERQIKIWFQNRRMKWKKDSKLKVKGGL"

     misc_feature    order(563..577,581..583,632..634,650..652,689..691,
                     695..700,707..712,716..724,728..733)
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    569..730
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(569..571,578..580,698..700,707..712,719..721)
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            552..1020
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cgtttctgcagtgaccgagtgttatttgtgagtctctttagggtgatattgtttgggaaatagcatgagctcatacgttgggaagtctttttctaagcagacgcaagacgcctcctcttgtagaatgcacacttttgacaactatggagctcacagtgagttccacgagtccaattacgcgtacgaagggcttgatctcggcggatccttcagttctcaaatccccaccaactctttgaggcgggaggcgataaacacaaccgaccgtgcaaggagcagtgcagcagttcagcgaacacagtcttgttcagctctgggctctcgtagctttgtaagcactcacgggtacaaccccctcagtcacggactgttgagccaaaaagccgaggggaatatggaagttatggagaagcccagcggcaagagccgcacagacgatatcaaaatggagactacttcagcgataaagcaacaaactaattcgactcagcgtcagaaccagtcgcagccgcagatatatccgtggatgacaaagctacacatgagccacgaatctgacggtaaaaggtcacgaaccagttacacccggtaccagactctggagttggagaaagagttccatttcaaccgatacctcacacgtcgcagacgtattgagattgccaataacctctgcttgaacgagcgccaaattaaaatatggttccagaaccgtcgcatgaagtggaagaaggactcaaagttgaaagtaaaaggaggactataaataatgtgttgcacgacttcaattacaacagcctgaaaataaaggcaatgttaacccttgaactaaaacaacgaatgatttaaaattgattttgttattaacaactgttgatgtctatcatttgtttacaatattatgttgttatgtgaatatgttgatattttcaatatttattgatagtgctctgtccccagtacggcagatgctaatttgaataatgtatgagcttaaacattgattatgctttactaaac

//