LOCUS       NM_001302222            2941 bp    mRNA    linear   VRT 16-OCT-2021
DEFINITION  Danio rerio argonaute RISC catalytic component 2 (ago2), mRNA.
ACCESSION   NM_001302222 XM_694134
VERSION     NM_001302222.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 2941)
  AUTHORS   Raman R, Ryon M and Jagadeeswaran P.
  TITLE     RNaseH-mediated simultaneous piggyback knockdown of multiple genes
            in adult zebrafish
  JOURNAL   Sci Rep 10 (1), 20187 (2020)
   PUBMED   33214638
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2941)
  AUTHORS   Martinez R, Tu W, Eng T, Allaire-Leung M, Pina B, Navarro-Martin L
            and Mennigen JA.
  TITLE     Acute and long-term metabolic consequences of early developmental
            Bisphenol A exposure in zebrafish (Danio rerio)
  JOURNAL   Chemosphere 256, 127080 (2020)
   PUBMED   32450349
REFERENCE   3  (bases 1 to 2941)
  AUTHORS   Liu Y, Zhu Z, Ho IHT, Shi Y, Li J, Wang X, Chan MTV and Cheng CHK.
  TITLE     Genetic Deletion of miR-430 Disrupts Maternal-Zygotic Transition
            and Embryonic Body Plan
  JOURNAL   Front Genet 11, 853 (2020)
   PUBMED   32849832
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2941)
  AUTHORS   Kretov DA, Walawalkar IA, Mora-Martin A, Shafik AM, Moxon S and
            Cifuentes D.
  TITLE     Ago2-Dependent Processing Allows miR-451 to Evade the Global
            MicroRNA Turnover Elicited during Erythropoiesis
  JOURNAL   Mol Cell 78 (2), 317-328 (2020)
   PUBMED   32191872
REFERENCE   5  (bases 1 to 2941)
  AUTHORS   Zhu Z, Liu Y, Xu W, Liu T, Xie Y, Sham KWY, Sha O and Cheng CHK.
  TITLE     Functional Characterization and Expression Analyses Show
            Differential Roles of Maternal and Zygotic Dgcr8 in Early Embryonic
            Development
  JOURNAL   Front Genet 11, 299 (2020)
   PUBMED   32296464
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2941)
  AUTHORS   Lopez-Bellido R, Barreto-Valer K, Sanchez-Simon FM and Rodriguez
            RE.
  TITLE     Cocaine modulates the expression of opioid receptors and miR-let-7d
            in zebrafish embryos
  JOURNAL   PLoS One 7 (11), e50885 (2012)
   PUBMED   23226419
REFERENCE   7  (bases 1 to 2941)
  AUTHORS   Zhu C, Smith T, McNulty J, Rayla AL, Lakshmanan A, Siekmann AF,
            Buffardi M, Meng X, Shin J, Padmanabhan A, Cifuentes D, Giraldez
            AJ, Look AT, Epstein JA, Lawson ND and Wolfe SA.
  TITLE     Evaluation and application of modularly assembled zinc-finger
            nucleases in zebrafish
  JOURNAL   Development 138 (20), 4555-4564 (2011)
   PUBMED   21937602
REFERENCE   8  (bases 1 to 2941)
  AUTHORS   McFarlane L, Svingen T, Braasch I, Koopman P, Schartl M and Wilhelm
            D.
  TITLE     Expansion of the Ago gene family in the teleost clade
  JOURNAL   Dev Genes Evol 221 (2), 95-104 (2011)
   PUBMED   21556854
REFERENCE   9  (bases 1 to 2941)
  AUTHORS   Liu W, Guan Y and Collodi P.
  TITLE     A zebrafish cell culture assay for the identification of microRNA
            targets
  JOURNAL   Zebrafish 7 (4), 343-348 (2010)
   PUBMED   21158564
REFERENCE   10 (bases 1 to 2941)
  AUTHORS   Cifuentes D, Xue H, Taylor DW, Patnode H, Mishima Y, Cheloufi S, Ma
            E, Mane S, Hannon GJ, Lawson ND, Wolfe SA and Giraldez AJ.
  TITLE     A novel miRNA processing pathway independent of Dicer requires
            Argonaute2 catalytic activity
  JOURNAL   Science 328 (5986), 1694-1698 (2010)
   PUBMED   20448148
  REMARK    GeneRIF: study found that pre-miR-451 processing requires Ago2
            catalytic activity in vivo; propose that Ago2-mediated cleavage of
            pre-miRNAs, followed by uridylation and trimming, generates
            functional miRNAs independently of Dicer
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from JX448392.1.
            
            On Oct 7, 2014 this sequence version replaced XM_694134.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: JX448392.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2168446, SAMEA2168447
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2941
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="AB"
                     /db_xref="taxon:7955"
                     /chromosome="19"
                     /map="19"
     gene            1..2941
                     /gene="ago2"
                     /note="argonaute RISC catalytic component 2"
                     /db_xref="GeneID:570630"
                     /db_xref="ZFIN:ZDB-GENE-110606-6"
     exon            1..227
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    176..178
                     /gene="ago2"
                     /note="upstream in-frame stop codon"
     CDS             203..2824
                     /gene="ago2"
                     /EC_number="3.1.26.n2"
                     /note="argonaute 2; eif2c2"
                     /codon_start=1
                     /product="protein argonaute-2"
                     /protein_id="NP_001289151.1"
                     /db_xref="GeneID:570630"
                     /db_xref="ZFIN:ZDB-GENE-110606-6"
                     /translation="

MYPIGAAGATELFQGRPSSGSDVSAPASPPAPQEYVFKPPQRPDFGTMGRTIKLQANFFEMEIPKLEVYHYEIDIKPEKCPRGVNREIVEHMVQHFKTQIFGDRKPVYDGRKNLYTAMPLPIGRDKVELEVTIPGEGKDRSFKVAIKWMSCVSLQALHEALSGRLPNIPFETIQALDVVMRHLPSMRYTPVGRSFFTPSEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFMCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQENGQTIECTVAQYFKDKYKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQDEISKLMRSANFNTDPYVREFGVMVRDDMTEVNGRVLQAPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTELLLKAFTDQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFKHLKYTYQGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQVKNVQKTTPQTLSNLCLKINVKLGGVNNILLPQGRPLVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQQHRQDIIQDLATMVRELLIQFYKSTRFKPTRIIYYRDGISEGQFNQVLQHELLAIREACIKLEKDYQPGITFVVVQKRHHTRLFCMDRNERVGKSGNIPAGTTVDTKITHPFEFDFYLCSHAGIQGTSRPSHYHVLWDDNHFTSDELQVLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDQQALAKAVQIHQDTLRTMYFA"

     misc_feature    518..742
                     /gene="ago2"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    770..922
                     /gene="ago2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    923..1285
                     /gene="ago2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1079..1081,1124..1126,1166..1168,1178..1180,
                     1232..1234,1253..1255,1259..1261)
                     /gene="ago2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1418..2695
                     /gene="ago2"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1829..1831,1841..1843,1877..1888,1895..1897,
                     1919..1921,1928..1930,1940..1942,1952..1954)
                     /gene="ago2"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2033..2035,2039..2041,2249..2251,2663..2665)
                     /gene="ago2"
                     /note="active site"
                     /db_xref="CDD:240015"
     exon            228..275
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            276..459
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            460..580
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            581..762
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            763..899
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            900..1034
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1035..1122
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1123..1270
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1271..1390
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1391..1513
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1514..1647
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1648..1832
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1833..1992
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            1993..2083
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            2084..2278
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            2279..2413
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            2414..2515
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            2516..2715
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
     exon            2716..2941
                     /gene="ago2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ggggaagggacggacggacgggccactcggagctctcgtgctccagcaactctgcgcgctcactttaatcttacttttcacctctgtatcgatgctgttttgaaagaaaacccagctcttccgttaccgcatgtgttacgtggcatcagaagacccaaaagtgtcggcccgggattgaattttgctgcagaaagcgattaaaatgtatcccattggagcagctggtgctactgagctgtttcagggacgtccgtcttcagggtcagatgtttctgctcccgcgtctcctccagcaccacaagaatatgtcttcaaaccacctcagcggccagactttggcacaatgggtaggacaatcaagcttcaggccaacttctttgaaatggaaattcccaagttggaggtttatcattatgaaatagacatcaagcctgagaaatgcccacggggagttaaccgtgaaatagttgagcacatggtccagcactttaaaacgcagatctttggagatcgaaagcctgtgtatgatgggaggaagaatctctacactgccatgcctttacccattggaagagacaaagtggagctggaggtcacgattcctggggagggaaaagacaggagctttaaagtcgctataaagtggatgtcctgtgtcagtctgcaagctttgcatgaagcactctctggacggctaccaaacatccctttcgagaccattcaggctctggatgttgtcatgagacatttgccctctatgaggtacaccccagtcggacgttcattcttcactccatcggagggctgctctaaccctcttggtggaggaagagaagtttggtttggttttcatcagtctgttcggccatcactctggaagatgatgctcaacattgatgtgtctgccactgcgttctacaaagctcaacccgtcattgaattcatgtgtgaggttttggattttaaaagcatcgaagagcagcaaaagcccttaacagattcccaaagagtgaagtttaccaaggagatcaagggtttgaaggttgaaattactcactgtggacaaatgaagaggaagtacagagtgtgtaatgtgacgagaagaccagccagccatcaaacgtttcctttgcagcaagagaatggtcagaccattgaatgcactgtcgcccagtacttcaaggataagtacaaactggtgctgcgatacccacatctcccgtgtttacaagttggtcaggagcagaaacacacctaccttccgttggaggtctgcaacattgtagccgggcagcgatgcatcaagaaactgacagacaatcagacctccactatgatacgtgccacagccaggtctgcgcccgaccgtcaggacgagatcagcaaactgatgagaagtgccaacttcaatacagatccttacgtgcgtgagtttggagtcatggtaagagacgatatgactgaagtcaatggtcgggttcttcaggcaccgtcgattctctatggtggaaggaacaaagcaatagcaaccccagtccagggcgtgtgggacatgaggaacaagcagttccacacagggattgaaatcaaagtttgggccattgcctgctttgccccacagaggcagtgcacagaactcctgctgaaggccttcactgaccagcttcgtaagatctcacgtgatgctgggatgcccattcagggccagccgtgcttttgcaaatatgcccagggagcagacagtgtggagcccatgttcaaacacctcaagtacacttatcaagggttacagttggtggtggtcatcttacccggcaagactcctgtttatgctgaggtgaagcgtgttggagacactgttctcggcatggccacgcagtgtgtccaggtgaagaatgtgcagaagaccacacctcaaaccctttctaacctctgcctcaagattaacgtcaaactgggtggagtcaacaacattcttcttccacagggcaggcccttggtgttccagcaaccagttatctttttgggtgcagatgtgactcatccaccagctggagatggcaagaaaccctcaattgctgctgtcgttggcagtatggatgcccacccaagcagatactgtgccacagtgcgggtgcagcagcaccggcaggacatcattcaggatctggcaaccatggtcagagagttactcatccagttctacaaatccacacgcttcaaaccaacacgtatcatctactacagagacggcatctctgaaggccagtttaaccaggttctacagcatgagctgctggctattcgtgaggcctgcatcaagctggagaaagattatcagccgggtatcaccttcgttgtagtacagaagagacaccacaccagactcttctgcatggacaggaacgaacgggttggaaagagtggaaacatccctgctggcaccactgtcgacaccaaaattactcatccattcgagtttgacttttatctttgcagtcatgctggaattcagggaaccagtaggccgtcccactatcatgtgctgtgggacgacaaccatttcacctctgacgagctgcaggtcctcacctaccagctgtgccacacctatgttcgctgcacccgctcggtctccattcctgcaccagcctattacgcccacttggtggcgtttcgcgcccgctaccacttggttgacaaagaacatgacagtgctgaaggcagtcacacatcaggtcagagtaacggcagagatcaacaagccctggccaaagctgtgcagatccaccaggacacactgcgcaccatgtacttcgcctgaacaaagccagaaccaagccccacaatcctgaaaacagcacggtgtgtgtgtatatgtgtgtgtgtgtgtgcgtgtgtgtaattttaagtgttatacaaacgagacccttcaaatgga

//