LOCUS       NM_001122973            1176 bp    mRNA    linear   VRT 09-OCT-2022
DEFINITION  Danio rerio LIM homeobox 4 (lhx4), mRNA.
ACCESSION   NM_001122973 XM_695590
VERSION     NM_001122973.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1176)
  AUTHORS   Guo R, Ge K, Wang Y, Lu M, Li F, Tian L, Gan L and Sheng D.
  TITLE     LIM Homeobox 4 (lhx4) regulates retinal neural differentiation and
            visual function in zebrafish
  JOURNAL   Sci Rep 11 (1), 1977 (2021)
   PUBMED   33479361
  REMARK    GeneRIF: LIM Homeobox 4 (lhx4) regulates retinal neural
            differentiation and visual function in zebrafish.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1176)
  AUTHORS   Postlethwait,J.H., Farnsworth,D.R. and Miller,A.C.
  TITLE     An intestinal cell type in zebrafish is the nexus for the
            SARS-CoV-2 receptor and the Renin-Angiotensin-Aldosterone System
            that contributes to COVID-19 comorbidities
  JOURNAL   bioRxiv (2020)
   PUBMED   32908984
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1176)
  AUTHORS   Bayes A, Collins MO, Reig-Viader R, Gou G, Goulding D, Izquierdo A,
            Choudhary JS, Emes RD and Grant SG.
  TITLE     Evolution of complexity in the zebrafish synapse proteome
  JOURNAL   Nat Commun 8, 14613 (2017)
   PUBMED   28252024
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1176)
  AUTHORS   Weger BD, Weger M, Gorling B, Schink A, Gobet C, Keime C, Poschet
            G, Jost B, Krone N, Hell R, Gachon F, Luy B and Dickmeis T.
  TITLE     Extensive Regulation of Diurnal Transcription and Metabolism by
            Glucocorticoids
  JOURNAL   PLoS Genet 12 (12), e1006512 (2016)
   PUBMED   27941970
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1176)
  AUTHORS   Pasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I,
            Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y and
            Bobe J.
  TITLE     Gene evolution and gene expression after whole genome duplication
            in fish: the PhyloFish database
  JOURNAL   BMC Genomics 17, 368 (2016)
   PUBMED   27189481
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1176)
  AUTHORS   Elkon R, Milon B, Morrison L, Shah M, Vijayakumar S, Racherla M,
            Leitch CC, Silipino L, Hadi S, Weiss-Gayet M, Barras E, Schmid CD,
            Ait-Lounis A, Barnes A, Song Y, Eisenman DJ, Eliyahu E, Frolenkov
            GI, Strome SE, Durand B, Zaghloul NA, Jones SM, Reith W and
            Hertzano R.
  TITLE     RFX transcription factors are essential for hearing in mice
  JOURNAL   Nat Commun 6, 8549 (2015)
   PUBMED   26469318
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 1176)
  AUTHORS   Diotel N, Rodriguez Viales R, Armant O, Marz M, Ferg M, Rastegar S
            and Strahle U.
  TITLE     Comprehensive expression map of transcription regulators in the
            adult zebrafish telencephalon reveals distinct neurogenic niches
  JOURNAL   J Comp Neurol 523 (8), 1202-1221 (2015)
   PUBMED   25556858
REFERENCE   8  (bases 1 to 1176)
  AUTHORS   Seredick S, Hutchinson SA, Van Ryswyk L, Talbot JC and Eisen JS.
  TITLE     Lhx3 and Lhx4 suppress Kolmer-Agduhr interneuron characteristics
            within zebrafish axial motoneurons
  JOURNAL   Development 141 (20), 3900-3909 (2014)
   PUBMED   25231761
  REMARK    GeneRIF: Lhx3 and Lhx4 have roles in suppressing Kolmer-Agduhr
            interneuron characteristics within zebrafish axial motoneurons
REFERENCE   9  (bases 1 to 1176)
  AUTHORS   Miyasaka N, Morimoto K, Tsubokawa T, Higashijima S, Okamoto H and
            Yoshihara Y.
  TITLE     From the olfactory bulb to higher brain centers: genetic
            visualization of secondary olfactory pathways in zebrafish
  JOURNAL   J Neurosci 29 (15), 4756-4767 (2009)
   PUBMED   19369545
REFERENCE   10 (bases 1 to 1176)
  AUTHORS   Hutchinson SA and Eisen JS.
  TITLE     Islet1 and Islet2 have equivalent abilities to promote motoneuron
            formation and to specify motoneuron subtype identity
  JOURNAL   Development 133 (11), 2137-2147 (2006)
   PUBMED   16672347
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CR381643.18,
            CT025732.9 and BX294388.5.
            
            On Apr 4, 2008 this sequence version replaced XM_695590.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: GFIL01014454.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA4476810 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                CR381643.18        6943-7027           c
            86-257              CT025732.9         18621-18792         c
            258-460             CT025732.9         13699-13901         c
            461-615             CT025732.9         7162-7316           c
            616-787             CT025732.9         4856-5027           c
            788-1176            BX294388.5         106170-106558       c
FEATURES             Location/Qualifiers
     source          1..1176
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="8"
                     /map="8"
     gene            1..1176
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="LIM homeobox 4"
                     /db_xref="GeneID:571943"
                     /db_xref="ZFIN:ZDB-GENE-060728-1"
     CDS             1..1176
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx4"
                     /protein_id="NP_001116445.1"
                     /db_xref="GeneID:571943"
                     /db_xref="ZFIN:ZDB-GENE-060728-1"
                     /translation="

MKMMQSAAVLPGESAVKGLPDILGVPLQQIPQCAGCSQHILDKFILKVLDRHWHSKCLKCADCHALLADKCFSRAGNVYCKEDFFKRFGTKCASCQQGIPPTQVVRKAQDFVYHLHCFACVMCSRQLATGDEFYLMEDGRLVCKEDYETAKQNDDSETGAKRPRTTITAKQLETLKSAYKNSPKPARHVREQLSSETGLDMRVVQVWFQNRRAKEKRLKKDAGRHRWGQFYKSVKRNRGSSKTEKESSADDAGLSDSELSFRDDQILSDLGHANGLYGSVGDVSNGNMLNGSFSLDGGGQPYHDLRAGSPYGLPQSPSSITSLPGHTPLLNNLGFSMDGLMGQAGQPSVGQALRAMAGGPTSDLSTGSSTGYPDFPTSPASWLDEMDHSQF"

     misc_feature    97..252
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="The first LIM domain of Lhx4; Region: LIM1_Lhx4;
                     cd09468"
                     /db_xref="CDD:188852"
     misc_feature    order(97..99,106..108,160..162,169..171,178..180,187..189,
                     238..240,247..249)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188852"
     misc_feature    274..441
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="The second LIM domain of Lhx3-Lhx4 family; Region:
                     LIM2_Lhx3_Lhx4; cd09376"
                     /db_xref="CDD:188762"
     misc_feature    order(274..276,283..285,340..342,349..351,358..360,
                     367..369,427..429,436..438)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188762"
     misc_feature    order(310..312,385..387)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Isl binding site; other site"
                     /db_xref="CDD:188762"
     misc_feature    order(481..495,499..501,550..552,568..570,607..609,
                     613..618,625..630,634..642,646..651)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    487..648
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(487..489,496..498,616..618,625..630,637..639)
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..85
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            86..257
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            258..460
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            461..615
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            616..787
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
     exon            788..1176
                     /gene="lhx4"
                     /gene_synonym="si:dkeyp-35f11.3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgaaaatgatgcaaagtgcggctgtgctgcccggcgagagcgcggtgaagggtctgccggacatcctcggagtgccactgcaacaaatccctcagtgcgcaggctgcagtcaacacatcctggataagttcatcctaaaggttctggatcggcactggcactcaaaatgcctgaagtgcgccgactgccacgcgctcctggcggacaaatgtttctctcgcgccgggaatgtctactgcaaagaggacttcttcaagcgtttcgggacaaagtgtgcatcgtgccagcaggggattcctcctacacaggtggtccggaaagctcaggactttgtgtaccatcttcactgttttgcatgtgtgatgtgcagcagacagttggccactggagatgagttctacctcatggaggacggcagactcgtgtgcaaagaggactacgaaacagccaagcagaacgatgattcagaaacaggagcaaaacgtccacgcaccaccatcacagccaaacagctggaaactctcaaaagcgcctataagaactcgccaaaaccagcaagacacgtgcgagagcaactttcctcagaaacgggcctggacatgagagtggtgcaggtgtggtttcagaacagacgggcaaaagaaaaacggctgaagaaagacgcgggccggcatcggtggggtcagttctacaaaagcgtcaaacgcaacagaggctccagtaaaacagagaaggaaagctcagccgacgatgcaggactcagtgacagtgagctcagtttcagagatgatcagatcctgtcagacttgggtcatgctaacggcctgtacggaagtgtcggcgacgtctctaatggtaacatgctcaacgggagcttctctttggatggaggcgggcagccttaccatgacctgcgggcagggagtccctatggcctgcctcagtcgccctcgtccatcacttccctgccaggccacactcctctactcaacaacttaggcttcagcatggacggcctcatgggtcaggccggtcagcccagtgtgggtcaagctctgagagccatggccggaggccccacctctgacctatccacaggaagcagcacgggatacccagacttccccaccagcccggcctcatggctcgatgaaatggaccactctcagttctga

//