LOCUS       NM_001037105             864 bp    mRNA    linear   VRT 09-JUL-2023
DEFINITION  Danio rerio dorsal root ganglia homeobox (drgx), mRNA.
ACCESSION   NM_001037105 XM_683802
VERSION     NM_001037105.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 864)
  AUTHORS   Lencer E, Prekeris R and Artinger KB.
  TITLE     Single-cell RNA analysis identifies pre-migratory neural crest
            cells expressing markers of differentiated derivatives
  JOURNAL   Elife 10, e66078 (2021)
   PUBMED   34397384
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 864)
  AUTHORS   Ladam F, Stanney W, Donaldson IJ, Yildiz O, Bobola N and Sagerstrom
            CG.
  TITLE     TALE factors use two distinct functional modes to control an
            essential zebrafish gene expression program
  JOURNAL   Elife 7, e36144 (2018)
   PUBMED   29911973
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 864)
  AUTHORS   Dyer C, Linker C, Graham A and Knight R.
  TITLE     Specification of sensory neurons occurs through diverse
            developmental programs functioning in the brain and spinal cord
  JOURNAL   Dev Dyn 243 (11), 1429-1439 (2014)
   PUBMED   25179866
REFERENCE   4  (bases 1 to 864)
  AUTHORS   Aoki M, Segawa H, Naito M and Okamoto H.
  TITLE     Identification of possible downstream genes required for the
            extension of peripheral axons in primary sensory neurons
  JOURNAL   Biochem Biophys Res Commun 445 (2), 357-362 (2014)
   PUBMED   24513284
REFERENCE   5  (bases 1 to 864)
  AUTHORS   Dyer C, Blanc E, Hanisch A, Roehl H, Otto GW, Yu T, Basson MA and
            Knight R.
  TITLE     A bi-modal function of Wnt signalling directs an FGF activity
            gradient to spatially regulate neuronal differentiation in the
            midbrain
  JOURNAL   Development 141 (1), 63-72 (2014)
   PUBMED   24284206
REFERENCE   6  (bases 1 to 864)
  AUTHORS   Regadas I, Matos MR, Monteiro FA, Gomez-Skarmeta JL, Lima D, Bessa
            J, Casares F and Reguenga C.
  TITLE     Several cis-regulatory elements control mRNA stability, translation
            efficiency, and expression pattern of Prrxl1 (paired related
            homeobox protein-like 1)
  JOURNAL   J Biol Chem 288 (51), 36285-36301 (2013)
   PUBMED   24214975
REFERENCE   7  (bases 1 to 864)
  AUTHORS   McCormick LJ, Hutt JA, Hazan J, Houart C and Cohen J.
  TITLE     The homeodomain transcription factor drg11 is expressed in primary
            sensory neurons and their putative CNS targets during embryonic
            development of the zebrafish
  JOURNAL   Gene Expr Patterns 7 (3), 289-296 (2007)
   PUBMED   17045851
  REMARK    GeneRIF: Results suggest that drg11 expression in the developing
            zebrafish is, like its mammalian homologous gene, predominantly
            localised to neurons in sensory processing areas of the embryonic
            nervous system and is both spatially and temporally regulated.
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY753211.1.
            
            On Nov 6, 2005 this sequence version replaced XM_683802.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY753211.1, BC162787.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505372, SAMEA3505373
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..864
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="13"
                     /map="13"
     gene            1..864
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /note="dorsal root ganglia homeobox"
                     /db_xref="GeneID:560399"
                     /db_xref="ZFIN:ZDB-GENE-070330-1"
     CDS             1..864
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /note="paired-like homeodomain transcription factor DRG11;
                     paired related homeobox protein-like 1; drg11"
                     /codon_start=1
                     /product="dorsal root ganglia homeobox protein"
                     /protein_id="NP_001032182.1"
                     /db_xref="GeneID:560399"
                     /db_xref="ZFIN:ZDB-GENE-070330-1"
                     /translation="

MFYFHCPPQLEGECCRTNTLNTNGFGNHASGDFDDGFLRRKQRRNRTTFTLQQLEALEAVFAQTHYPDVFAREELAMKINLTEARVQVWFQNRRAKWRKTERGTSEQDGGKEQMNEGNPPARNLNQSPVDHSRSKKEPMELQQNINRVVGSGGPFFPSCLPGTLLNTATYAQALSQVATLKGSPLCSCCVPDPMGLSFLPPYGCQSNRTASVAALRMKAREHSEAVLQSANLLGTGSTTGPAAGPALPLSQNTGGDSSPNSSTPKITSLRRTPDKHLHCQKEGPDKK"

     misc_feature    order(127..141,145..147,196..198,214..216,253..255,
                     259..264,271..276,280..288,292..297)
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(133..135,142..144,262..264,271..276,283..285)
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    136..294
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    619..672
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /note="OAR domain; Region: OAR; pfam03826"
                     /db_xref="CDD:427530"
     exon            1..58
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /inference="alignment:Splign:2.1.0"
     exon            59..159
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /inference="alignment:Splign:2.1.0"
     exon            160..261
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /inference="alignment:Splign:2.1.0"
     exon            262..431
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /inference="alignment:Splign:2.1.0"
     exon            432..544
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /inference="alignment:Splign:2.1.0"
     exon            545..864
                     /gene="drgx"
                     /gene_synonym="prrxl1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgttttactttcactgtcctccacagttagaaggagagtgctgcaggaccaacacattgaacacaaatgggttcgggaatcacgcctctggagactttgatgacggttttctgcgcagaaaacaacgaagaaacaggacgactttcaccttacaacagttggaggctttggaggcggtttttgcacagacgcactatccagacgtgttcgcgagggaagagttggctatgaaaatcaacctgacagaggctcgcgtccaggtttggtttcaaaaccgaagagcaaagtggaggaaaacagaaagaggaacttcggagcaggacggaggcaaagaacaaatgaatgaaggcaatcctcctgcacgaaacctcaaccagtctcctgttgaccacagcagaagcaagaaagaaccaatggagctccagcagaacattaacagagtggtgggttcgggaggaccttttttcccatcctgtctgcctgggactctgctgaacacagccacttacgcgcaagctttatcacaagtggcaactttaaaaggaagtccgctgtgttcctgctgtgtgcccgacccaatgggcctgtccttcctgccaccatacgggtgtcagagtaaccgcaccgccagcgtggcagccctgcggatgaaggccagagagcattcagaggccgtgctccagtctgccaacctgctgggcacagggtctacaaccgggcctgcagcgggcccagcgcttcctctcagccaaaacaccggaggagactccagtccaaactccagtaccccaaagatcacatcactacggagaactccagacaagcatctgcactgccaaaaggagggtccggataagaaatga

//